View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1773_low_141 (Length: 255)

Name: NF1773_low_141
Description: NF1773
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1773_low_141
NF1773_low_141
[»] chr1 (9 HSPs)
chr1 (1-156)||(10494493-10494649)
chr1 (1-156)||(2077719-2077875)
chr1 (1-156)||(27787032-27787187)
chr1 (1-106)||(14351503-14351608)
chr1 (1-156)||(29099235-29099390)
chr1 (1-135)||(11814325-11814459)
chr1 (77-156)||(15495669-15495748)
chr1 (1-124)||(25537441-25537561)
chr1 (1-71)||(26842261-26842331)
[»] chr5 (10 HSPs)
chr5 (1-144)||(12155947-12156091)
chr5 (1-156)||(40600181-40600337)
chr5 (1-135)||(26331369-26331503)
chr5 (1-135)||(26331710-26331845)
chr5 (1-135)||(42269102-42269237)
chr5 (9-135)||(24867387-24867513)
chr5 (74-156)||(40680667-40680748)
chr5 (1-135)||(11470547-11470683)
chr5 (77-156)||(42221111-42221191)
chr5 (77-156)||(30248329-30248409)
[»] chr6 (6 HSPs)
chr6 (1-135)||(10772571-10772706)
chr6 (1-135)||(30845099-30845234)
chr6 (1-144)||(24350499-24350643)
chr6 (5-135)||(10670314-10670444)
chr6 (1-156)||(24842844-24842998)
chr6 (77-156)||(31026650-31026729)
[»] chr2 (9 HSPs)
chr2 (1-135)||(27888493-27888627)
chr2 (3-156)||(1532998-1533151)
chr2 (1-156)||(9910272-9910428)
chr2 (1-144)||(14951149-14951293)
chr2 (1-144)||(6186583-6186727)
chr2 (1-144)||(38531671-38531814)
chr2 (1-155)||(40899925-40900079)
chr2 (77-156)||(6705301-6705380)
chr2 (77-156)||(33544097-33544177)
[»] chr7 (5 HSPs)
chr7 (1-135)||(24717723-24717858)
chr7 (1-156)||(43047989-43048145)
chr7 (1-135)||(21590828-21590962)
chr7 (1-156)||(32978916-32979071)
chr7 (1-93)||(26711885-26711978)
[»] chr4 (6 HSPs)
chr4 (1-135)||(45872842-45872976)
chr4 (1-132)||(52635364-52635495)
chr4 (56-144)||(55728357-55728446)
chr4 (78-135)||(12130335-12130392)
chr4 (3-133)||(42677894-42678024)
chr4 (77-135)||(14440920-14440978)
[»] chr3 (5 HSPs)
chr3 (1-153)||(46743178-46743330)
chr3 (42-144)||(52984642-52984745)
chr3 (1-108)||(31698941-31699048)
chr3 (58-135)||(52991648-52991725)
chr3 (30-67)||(31625689-31625726)
[»] scaffold0974 (1 HSPs)
scaffold0974 (1-132)||(2704-2836)
[»] chr8 (5 HSPs)
chr8 (1-135)||(3763288-3763423)
chr8 (32-135)||(39580374-39580477)
chr8 (1-156)||(5514976-5515132)
chr8 (1-135)||(15050331-15050463)
chr8 (1-135)||(10181781-10181915)
[»] scaffold0083 (1 HSPs)
scaffold0083 (42-131)||(2867-2958)


Alignment Details
Target: chr1 (Bit Score: 109; Significance: 6e-55; HSPs: 9)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 109; E-Value: 6e-55
Query Start/End: Original strand, 1 - 156
Target Start/End: Complemental strand, 10494649 - 10494493
Alignment:
Q  1 tttggtaggtttgatggttattttataggggttttgcaatggtttgccacaagatttgtttctgctattgcacagacgtttagactttggtttttggaga 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| || ||||||||||||| ||||||||||    
T  10494649 tttggtaggtttgatggttattttataggggttttgcaatggtttggcacaagatttgtttctgctattgcaaaggcgtttagactttgatttttggaga 10494550  T
Q  101 tgacttttggg-tctggtgtttagtttttattggttccaggggccctaagtggaggg 156  Q
    ||||||||||| | || ||||||||||||||||||| | || ||||| |||||||||    
T  10494549 tgacttttgggttttgttgtttagtttttattggtttcgggagcccttagtggaggg 10494493  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 89; E-Value: 5e-43
Query Start/End: Original strand, 1 - 156
Target Start/End: Original strand, 2077719 - 2077875
Alignment:
Q  1 tttggtaggtttgatggttattttataggggttttgcaatggtttgccacaagatttgtttctgctattgcacagacgtttagactttggtttttggaga 100  Q
    |||||||||||||||| |||||||  | ||||||||||| |||||  ||||||| |||||| ||||||||| ||||||||||||||||||||||||||||    
T  2077719 tttggtaggtttgatgattattttggatgggttttgcaacggttttgcacaagacttgtttatgctattgctcagacgtttagactttggtttttggaga 2077818  T
Q  101 tgac-ttttgggtctggtgtttagtttttattggttccaggggccctaagtggaggg 156  Q
    |||| |||||| | |||||||||||||||||||||| |||||||||| |||| ||||    
T  2077819 tgactttttggttttggtgtttagtttttattggtttcaggggcccttagtgaaggg 2077875  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 1 - 156
Target Start/End: Original strand, 27787032 - 27787187
Alignment:
Q  1 tttggtaggtttgatggttattttataggggttttgcaatggtttgccacaagatttgtttctgctattgcacagacgtttagactttggtttttggaga 100  Q
    ||||||||||||||||||||||||  || ||||||  ||||||||| |  ||||||||||||||||||||| ||||||||| ||||||||||||||||||    
T  27787032 tttggtaggtttgatggttattttggagaggttttttaatggtttggcttaagatttgtttctgctattgcgcagacgtttggactttggtttttggaga 27787131  T
Q  101 tgacttttgggtctggtgtttagtttttattggttccaggggccctaagtggaggg 156  Q
    |||||| | ||| |||||||||||||||||||||| |  ||||||| |||||||||    
T  27787132 tgacttcttggtttggtgtttagtttttattggtttcgagggccctcagtggaggg 27787187  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 1 - 106
Target Start/End: Original strand, 14351503 - 14351608
Alignment:
Q  1 tttggtaggtttgatggttattttataggggttttgcaatggtttgccacaagatttgtttctgctattgcacagacgtttagactttggtttttggaga 100  Q
    ||||||||||||||||||||||||  |||||||||||||||||||| |||||||||||||||||||||||| | |  ||||||||||| |||||||||||    
T  14351503 tttggtaggtttgatggttattttggaggggttttgcaatggtttggcacaagatttgtttctgctattgcgcgggtgtttagactttagtttttggaga 14351602  T
Q  101 tgactt 106  Q
    ||||||    
T  14351603 tgactt 14351608  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #5
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 1 - 156
Target Start/End: Complemental strand, 29099390 - 29099235
Alignment:
Q  1 tttggtaggtttgatggttattttataggggttttgcaatggtttgccacaagatttgtttctgctattgcacagacgtttagactttggtttttggaga 100  Q
    ||||||| ||||||||||||||||  || |||||| ||| | | || ||||| |||||||| ||||||||| || |||||||||||||||||||||||||    
T  29099390 tttggtaagtttgatggttattttggagaggtttttcaacgatatggcacaaaatttgtttatgctattgcgcaaacgtttagactttggtttttggaga 29099291  T
Q  101 tgacttttgggtctggtgtttagtttttattggttccaggggccctaagtggaggg 156  Q
    |||||| | |||  |||||||||| | |||||||| |  ||||||| |||||||||    
T  29099290 tgacttcttggtgcggtgtttagtctctattggtttcgagggccctcagtggaggg 29099235  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #6
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 1 - 135
Target Start/End: Complemental strand, 11814459 - 11814325
Alignment:
Q  1 tttggtaggtttgatggttattttataggggttttgcaatggtttgccacaagatttgtttctgctattgcacagacgtttagactttggtttttggaga 100  Q
    |||| ||||||||||||||| |||  |||||||||||||  ||| | |||||||||| ||||||||||||| ||  ||||||||||| ||||||||||||    
T  11814459 tttgctaggtttgatggttactttggaggggttttgcaacagttaggcacaagatttatttctgctattgcgcaagcgtttagacttaggtttttggaga 11814360  T
Q  101 tgacttttgggtctggtgtttagtttttattggtt 135  Q
    | ||||||  || |||| |||| ||||||||||||    
T  11814359 tcactttttagtttggtatttaatttttattggtt 11814325  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #7
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 77 - 156
Target Start/End: Complemental strand, 15495748 - 15495669
Alignment:
Q  77 cgtttagactttggtttttggagatgacttttgggtctggtgtttagtttttattggttccaggggccctaagtggaggg 156  Q
    ||||||||||||||||||||| |||||||| | ||| ||||||||||||||||||| || |  ||||||| |||||||||    
T  15495748 cgtttagactttggtttttggtgatgacttcttggtttggtgtttagtttttattgctttcgagggccctcagtggaggg 15495669  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #8
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 1 - 124
Target Start/End: Complemental strand, 25537561 - 25537441
Alignment:
Q  1 tttggtaggtttgatggttattttataggggttttgcaatggtttgccacaagatttgtttctgctattgcacagacgtttagactttggtttttggaga 100  Q
    ||||||||||||||||||||||  | |||  |||| ||| ||| || |||||||||||||||||||||| |  || ||||||||||||| |||||  |||    
T  25537561 tttggtaggtttgatggttattggagagg--tttttcaacggtatgacacaagatttgtttctgctatttcgtaggcgtttagactttgattttt-taga 25537465  T
Q  101 tgacttttgggtctggtgtttagt 124  Q
    ||| || | ||| |||||||||||    
T  25537464 tgatttcttggtttggtgtttagt 25537441  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #9
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 1 - 71
Target Start/End: Original strand, 26842261 - 26842331
Alignment:
Q  1 tttggtaggtttgatggttattttataggggttttgcaatggtttgccacaagatttgtttctgctattgc 71  Q
    |||||||||||||||||||| |||  || |||||| ||| ||| || |||||||||||||||| |||||||    
T  26842261 tttggtaggtttgatggttagtttggagaggtttttcaacggtatgacacaagatttgtttctcctattgc 26842331  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 85; Significance: 1e-40; HSPs: 10)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 1 - 144
Target Start/End: Complemental strand, 12156091 - 12155947
Alignment:
Q  1 tttggtaggtttgatggttattttataggggttttgcaatggtttgccacaagatttgtttctgctattgcacagacgtttagactttggtttttggaga 100  Q
    ||||||||||||||||||||||||  |||||||||||||||||||| |||||||||||||||||||||||| | |  ||||||||||| |||||||||||    
T  12156091 tttggtaggtttgatggttattttggaggggttttgcaatggtttgacacaagatttgtttctgctattgcgcgggtgtttagactttagtttttggaga 12155992  T
Q  101 tgactt-ttgggtctggtgtttagtttttattggttccaggggcc 144  Q
    |||||| |||  | ||||||||| |||||||||||| ||||||||    
T  12155991 tgacttcttgattttggtgtttaatttttattggtttcaggggcc 12155947  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 1 - 156
Target Start/End: Original strand, 40600181 - 40600337
Alignment:
Q  1 tttggtaggtttgatggttattttataggggttttgcaatggtttgccacaagatttgtttctgctattgcacagacgtttagactttggtttttggaga 100  Q
    ||||||||||||||||||||||||  | ||||||||||| |||||| ||||||| |||||| |||||||||  || |||| | |||||| ||||||||||    
T  40600181 tttggtaggtttgatggttattttggacgggttttgcaacggtttggcacaagacttgtttttgctattgcttaggcgttcatactttgatttttggaga 40600280  T
Q  101 tgac-ttttgggtctggtgtttagtttttattggttccaggggccctaagtggaggg 156  Q
    |||| |||||| |||||||||||||||||||||||| ||||||||||  ||||||||    
T  40600281 tgactttttggttctggtgtttagtttttattggtttcaggggccctcggtggaggg 40600337  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 1 - 135
Target Start/End: Original strand, 26331369 - 26331503
Alignment:
Q  1 tttggtaggtttgatggttattttataggggttttgcaatggtttgccacaagatttgtttctgctattgcacagacgtttagactttggtttttggaga 100  Q
    |||||||||||||||| |||||||| ||  ||||| ||| | |||   ||||||||||||| ||||||||||||||||||||||||||||||||||||||    
T  26331369 tttggtaggtttgatgattattttagagatgtttttcaacgatttcgtacaagatttgtttatgctattgcacagacgtttagactttggtttttggaga 26331468  T
Q  101 tgacttttgggtctggtgtttagtttttattggtt 135  Q
    |||||| | ||| |||||| |||||||||||||||    
T  26331469 tgacttattggtttggtgtctagtttttattggtt 26331503  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 72; E-Value: 7e-33
Query Start/End: Original strand, 1 - 135
Target Start/End: Original strand, 26331710 - 26331845
Alignment:
Q  1 tttggtaggtttgatggttattttataggggttttgcaatggtttgccacaagatttgtttctgctattgcacagacgtttagactttggtttttggaga 100  Q
    |||||||||||||||| |||||||| ||  ||||| ||| | |||   ||||||||||||| ||||||||||||||||||||||||||||||||||||||    
T  26331710 tttggtaggtttgatgattattttagagatgtttttcaacgatttcgtacaagatttgtttatgctattgcacagacgtttagactttggtttttggaga 26331809  T
Q  101 tgacttt-tgggtctggtgtttagtttttattggtt 135  Q
    ||||||| | ||| |||||| |||||||||||||||    
T  26331810 tgactttattggtttggtgtctagtttttattggtt 26331845  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #5
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 1 - 135
Target Start/End: Original strand, 42269102 - 42269237
Alignment:
Q  1 tttggtaggtttgatggttattttataggggttttgcaatggtttgccacaagatttgtttctgctattgcacagacgtttagactttggtttttggaga 100  Q
    ||||||||| ||||||||||||||  | |||||||||||  ||||| ||||||| |||||||| ||||||| ||| |||||||| |||||||||||||||    
T  42269102 tttggtaggattgatggttattttggatgggttttgcaacagtttggcacaagacttgtttctactattgctcaggcgtttagaatttggtttttggaga 42269201  T
Q  101 tgac-ttttgggtctggtgtttagtttttattggtt 135  Q
    |||| |||||| |  |||||| ||||||||||||||    
T  42269202 tgactttttggttacggtgttcagtttttattggtt 42269237  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #6
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 9 - 135
Target Start/End: Original strand, 24867387 - 24867513
Alignment:
Q  9 gtttgatggttattttataggggttttgcaatggtttgccacaagatttgtttctgctattgcacagacgtttagactttggtttttggagatgactttt 108  Q
    ||||||||||||||||  || || ||| ||| || ||| |||||||||||||| ||||||||| ||  |||||||||||||||||||||||||||||| |    
T  24867387 gtttgatggttattttggagaggattttcaacggattggcacaagatttgtttatgctattgcgcatgcgtttagactttggtttttggagatgacttct 24867486  T
Q  109 gggtctggtgtttagtttttattggtt 135  Q
      || ||  ||||||||||||||||||    
T  24867487 ttgtttgacgtttagtttttattggtt 24867513  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #7
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 74 - 156
Target Start/End: Complemental strand, 40680748 - 40680667
Alignment:
Q  74 agacgtttagactttggtttttggagatgacttttgggtctggtgtttagtttttattggttccaggggccctaagtggaggg 156  Q
    |||||||||||||||||||||||| ||||||| || ||| |||||||||||||||||||||| |  ||||||| |||||||||    
T  40680748 agacgtttagactttggtttttggtgatgactctt-ggtttggtgtttagtttttattggtttcgagggccctcagtggaggg 40680667  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #8
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 1 - 135
Target Start/End: Complemental strand, 11470683 - 11470547
Alignment:
Q  1 tttggtaggtttgatggttattttataggggttttgcaatggtttgccacaagatttgtttc-tgctattgcacagacgtttagactttggtttttggag 99  Q
    ||||||||||||||| | ||||||  ||||||||||||| |||||| ||||||||||||||| || |||||  | |  ||||||| |||||||||| |||    
T  11470683 tttggtaggtttgatagctattttgaaggggttttgcaacggtttggcacaagatttgtttcttgatattgtgcgggagtttagattttggttttttgag 11470584  T
Q  100 atgacttt-tgggtctggtgtttagtttttattggtt 135  Q
    |||| ||| ||| | || ||||| |||||||||||||    
T  11470583 atgattttatggttttgatgttttgtttttattggtt 11470547  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #9
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 77 - 156
Target Start/End: Complemental strand, 42221191 - 42221111
Alignment:
Q  77 cgtttagactttggtttttggagatgacttt-tgggtctggtgtttagtttttattggttccaggggccctaagtggaggg 156  Q
    |||||| ||||||||||| |||||||||||| ||| | |||||||||||||||||||||| | |||||||| | |||||||    
T  42221191 cgtttatactttggttttgggagatgactttgtggttttggtgtttagtttttattggtttcgggggccctcaatggaggg 42221111  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #10
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 77 - 156
Target Start/End: Complemental strand, 30248409 - 30248329
Alignment:
Q  77 cgtttagactttggtttttggagatgacttt-tgggtctggtgtttagtttttattggttccaggggccctaagtggaggg 156  Q
    |||||||| |||| |||| |||||||||||| ||| | |||||||||||||||||||||| | | |||||| |||||||||    
T  30248409 cgtttagagtttgtttttgggagatgactttatggttttggtgtttagtttttattggtttcggaggcccttagtggaggg 30248329  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 80; Significance: 1e-37; HSPs: 6)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 1 - 135
Target Start/End: Complemental strand, 10772706 - 10772571
Alignment:
Q  1 tttggtaggtttgatggttattttataggggttttgcaatggtttgccacaagatttgtttctgctattgcacagacgtttagactttggtttttggaga 100  Q
    ||||||||||||||||||||||||  | ||||||||||| |||||| ||||||| |||||||||| ||||| ||  ||||||||||||| ||||||||||    
T  10772706 tttggtaggtttgatggttattttggatgggttttgcaacggtttggcacaagacttgtttctgccattgctcaagcgtttagactttgatttttggaga 10772607  T
Q  101 tgac-ttttgggtctggtgtttagtttttattggtt 135  Q
    |||| |||||| ||||||||||||||||||||||||    
T  10772606 tgactttttggttctggtgtttagtttttattggtt 10772571  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 1 - 135
Target Start/End: Complemental strand, 30845234 - 30845099
Alignment:
Q  1 tttggtaggtttgatggttattttataggggttttgcaatggtttgccacaagatttgtttctgctattgcacagacgtttagactttggtttttggaga 100  Q
    ||||||||||||||||||||||||  ||||||||||||| |||||| ||||||||||||||||||||||||   |  ||||||||||||||||||| |||    
T  30845234 tttggtaggtttgatggttattttggaggggttttgcaacggtttgacacaagatttgtttctgctattgcgtgggtgtttagactttggtttttgaaga 30845135  T
Q  101 tgac-ttttgggtctggtgtttagtttttattggtt 135  Q
    |||| |||||| | ||||||||||||||||||||||    
T  30845134 tgactttttggttttggtgtttagtttttattggtt 30845099  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 69; E-Value: 5e-31
Query Start/End: Original strand, 1 - 144
Target Start/End: Original strand, 24350499 - 24350643
Alignment:
Q  1 tttggtaggtttgatggttattttataggggttttgcaatggtttgccacaagatttgtttctgctattgcacagacgtttagactttggtttttggaga 100  Q
    ||||||| ||||||||||||||||  ||||||||||||| |||||  ||||| |||||||||||||||||| | |  ||||||||||| |||||||||||    
T  24350499 tttggtaagtttgatggttattttggaggggttttgcaacggtttagcacaaaatttgtttctgctattgcgcgggagtttagactttagtttttggaga 24350598  T
Q  101 tgactt-ttgggtctggtgtttagtttttattggttccaggggcc 144  Q
    |||||| |||| | |||||||||||||| ||||||| || |||||    
T  24350599 tgacttcttggttttggtgtttagttttgattggtttcaagggcc 24350643  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #4
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 5 - 135
Target Start/End: Original strand, 10670314 - 10670444
Alignment:
Q  5 gtaggtttgatggttattttataggggttttgcaatggtttgccacaagatttgtttctgctattgcacagacgtttagactttggtttttggagatgac 104  Q
    |||| |||||| ||||||||  || |||||| ||| |||||| |||||||||||||||||||||||| ||| | |||||||||||| ||||||| |||||    
T  10670314 gtagatttgatagttattttggagaggtttttcaacggtttgacacaagatttgtttctgctattgcgcaggcatttagactttggattttggatatgac 10670413  T
Q  105 ttttgggtctggtgtttagtttttattggtt 135  Q
    || |  || ||||||||||||||||||||||    
T  10670414 ttctttgtttggtgtttagtttttattggtt 10670444  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #5
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 1 - 156
Target Start/End: Complemental strand, 24842998 - 24842844
Alignment:
Q  1 tttggtaggtttgatggttattttataggggttttgcaatggtttgccacaagatttgtttctgctattgcacagacgtttagactttggtttttggaga 100  Q
    ||||||||||||||||||| ||||  |||| |||  |||  ||||  |||||||||||||| ||||| ||| | |  ||||| || |||||||||||||     
T  24842998 tttggtaggtttgatggttcttttggaggg-tttaacaacagtttagcacaagatttgtttttgctactgctcgggtgtttaaacgttggtttttggagc 24842900  T
Q  101 tgac-ttttgggtctggtgtttagtttttattggttccaggggccctaagtggaggg 156  Q
    |||| |||||| | |||||||||||||||||||||| | |||||||| ||| |||||    
T  24842899 tgactttttggttttggtgtttagtttttattggtttc-ggggcccttagtagaggg 24842844  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #6
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 77 - 156
Target Start/End: Original strand, 31026650 - 31026729
Alignment:
Q  77 cgtttagactttggtttttggagatgacttttgggtctggtgtttagtttttattggttccaggggccctaagtggaggg 156  Q
    |||||||||||||||||||||||| ||||| | ||| ||||  ||||||||||||||||    ||||||| |||||||||    
T  31026650 cgtttagactttggtttttggagacgacttattggtttggttattagtttttattggttttgagggccctcagtggaggg 31026729  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 79; Significance: 5e-37; HSPs: 9)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 79; E-Value: 5e-37
Query Start/End: Original strand, 1 - 135
Target Start/End: Complemental strand, 27888627 - 27888493
Alignment:
Q  1 tttggtaggtttgatggttattttataggggttttgcaatggtttgccacaagatttgtttctgctattgcacagacgtttagactttggtttttggaga 100  Q
    ||||||||||| ||||||||||||  || ||||||  || |||||| |||||||||||||||| ||||||| ||||||||||||||||||||||||||||    
T  27888627 tttggtaggttcgatggttattttggagaggttttttaaaggtttgacacaagatttgtttctactattgcgcagacgtttagactttggtttttggaga 27888528  T
Q  101 tgacttttgggtctggtgtttagtttttattggtt 135  Q
    |||||| | ||| || |||||||||||||||||||    
T  27888527 tgacttcttggtttgatgtttagtttttattggtt 27888493  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 3 - 156
Target Start/End: Complemental strand, 1533151 - 1532998
Alignment:
Q  3 tggtaggtttgatggttattttataggggttttgcaatggtttgccacaagatttgtttctgctattgcacagacgtttagactttggtttttggagatg 102  Q
    ||||| ||||||||||||||||  || ||||||  ||||||||| |||||||||||||||||||||||| || |||||| ||||||||||||||||||||    
T  1533151 tggtaagtttgatggttattttggagaggttttttaatggtttggcacaagatttgtttctgctattgcgcaaacgtttggactttggtttttggagatg 1533052  T
Q  103 acttttgggtctggtgtttagtttttattggttccaggggccctaagtggaggg 156  Q
    |||| | ||| |||||||||| |||||||||||    ||||||| |||||||||    
T  1533051 acttcttggtttggtgtttagcttttattggttttgagggcccttagtggaggg 1532998  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 77; E-Value: 8e-36
Query Start/End: Original strand, 1 - 156
Target Start/End: Complemental strand, 9910428 - 9910272
Alignment:
Q  1 tttggtaggtttgatggttattttataggggttttgcaatggtttgccacaagatttgtttctgctattgcacagacgtttagactttggtttttggaga 100  Q
    ||||||||| ||||| ||||||||  | ||||||||||| |||||| ||||||| |||||||||||||||| ||| ||||||||||||||||||||||||    
T  9910428 tttggtaggattgatagttatttttgatgggttttgcaacggtttgtcacaagacttgtttctgctattgctcaggcgtttagactttggtttttggaga 9910329  T
Q  101 tgac-ttttgggtctggtgtttagtttttattggttccaggggccctaagtggaggg 156  Q
    |||| |||||| | |||||||||||||||||| |||   |||||| | |||||||||    
T  9910328 tgactttttggttatggtgtttagtttttattagtttggggggccttcagtggaggg 9910272  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 77; E-Value: 8e-36
Query Start/End: Original strand, 1 - 144
Target Start/End: Original strand, 14951149 - 14951293
Alignment:
Q  1 tttggtaggtttgatggttattttataggggttttgcaatggtttgccacaagatttgtttctgctattgcacagacgtttagactttggtttttggaga 100  Q
    ||||||||||||||||||||||||  ||||||||||||| |||||| |||||||||||||||||||||||| | |  ||||||||||| || ||||||||    
T  14951149 tttggtaggtttgatggttattttggaggggttttgcaacggtttggcacaagatttgtttctgctattgcgcgggtgtttagactttagtgtttggaga 14951248  T
Q  101 tgactt-ttgggtctggtgtttagtttttattggttccaggggcc 144  Q
    ||| || |||| | | |||||||||||||||||||| ||||||||    
T  14951249 tgatttcttggtttttgtgtttagtttttattggtttcaggggcc 14951293  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #5
Raw Score: 69; E-Value: 5e-31
Query Start/End: Original strand, 1 - 144
Target Start/End: Original strand, 6186583 - 6186727
Alignment:
Q  1 tttggtaggtttgatggttattttataggggttttgcaatggtttgccacaagatttgtttctgctattgcacagacgtttagactttggtttttggaga 100  Q
    ||||||| |||||||  |||||||  ||||||||||||| |||||| |||||||||||||| ||||||||| | |  ||||||||||| |||||||||||    
T  6186583 tttggtaagtttgataattattttgaaggggttttgcaacggtttgacacaagatttgtttttgctattgcgcgggtgtttagactttagtttttggaga 6186682  T
Q  101 tgactt-ttgggtctggtgtttagtttttattggttccaggggcc 144  Q
    |||||| |||| | ||||||||| |||||||||||| ||||||||    
T  6186683 tgacttcttggttttggtgtttaatttttattggtttcaggggcc 6186727  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #6
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 1 - 144
Target Start/End: Original strand, 38531671 - 38531814
Alignment:
Q  1 tttggtaggtttgatggttattttataggggttttgcaatggtttgccacaagatttgtttctgctattgcacagacgtttagactttggtttttggaga 100  Q
    ||||||||||||||||||| ||||  |||| ||||||||  ||||  |||||||||||||||||||| | | |||  |||||||| ||||||||||||||    
T  38531671 tttggtaggtttgatggttcttttggaggg-ttttgcaacagtttagcacaagatttgtttctgctactacgcaggtgtttagacgttggtttttggaga 38531769  T
Q  101 tgac-ttttgggtctggtgtttagtttttattggttccaggggcc 144  Q
    |||| |||||| | |||||||||||||||||||||| | ||||||    
T  38531770 tgactttttggttttggtgtttagtttttattggtttcgggggcc 38531814  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #7
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 1 - 155
Target Start/End: Complemental strand, 40900079 - 40899925
Alignment:
Q  1 tttggtaggtttgatggttattttataggggttttgcaatggtttgccacaagatttgtttctgctattgcacagacgtttagactttggtttttggaga 100  Q
    |||||||||||| |||| ||||||  || ||||||   | |||||| |||||||||||||||| ||| |||| ||||||||||| |||||||||||||||    
T  40900079 tttggtaggtttcatggatattttggagaggtttttttacggtttggcacaagatttgtttctactaatgcatagacgtttagaatttggtttttggaga 40899980  T
Q  101 tgacttttgggtctggtgtttagtttttattggttccaggggccctaagtggagg 155  Q
    || ||| | ||| || ||||||||||||||||||  |  ||||||| ||||||||    
T  40899979 tggcttcttggtttgatgtttagtttttattggtctcgagggccctcagtggagg 40899925  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #8
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 77 - 156
Target Start/End: Complemental strand, 6705380 - 6705301
Alignment:
Q  77 cgtttagactttggtttttggagatgacttttgggtctggtgtttagtttttattggttccaggggccctaagtggaggg 156  Q
    ||||||||||||||||||||| |||||||| | ||| |||||||||||||||||||||| |  ||||||| |||||||||    
T  6705380 cgtttagactttggtttttggtgatgacttcttggtttggtgtttagtttttattggtttcgagggccctcagtggaggg 6705301  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #9
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 77 - 156
Target Start/End: Complemental strand, 33544177 - 33544097
Alignment:
Q  77 cgtttagactttggtttttggagatgacttt-tgggtctggtgtttagtttttattggttccaggggccctaagtggaggg 156  Q
    |||||| | |||| |||| |||||||||||| ||| | ||||||||||||||||||||||   |||||||| |||||||||    
T  33544177 cgtttatagtttgtttttgggagatgactttgtggctttggtgtttagtttttattggttttgggggccctcagtggaggg 33544097  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 76; Significance: 3e-35; HSPs: 5)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 1 - 135
Target Start/End: Complemental strand, 24717858 - 24717723
Alignment:
Q  1 tttggtaggtttgatggttattttataggggttttgcaatggtttgccacaagatttgtttctgctattgcacagacgtttagactttggtttttggaga 100  Q
    ||||||||| ||||||||||||||  | |||||||||||  ||||| ||||||| |||||||| ||||||| ||| ||||||||||||||||||||||||    
T  24717858 tttggtaggattgatggttattttggatgggttttgcaactgtttggcacaagacttgtttctactattgctcaggcgtttagactttggtttttggaga 24717759  T
Q  101 tgac-ttttgggtctggtgtttagtttttattggtt 135  Q
    |||| |||||| | ||||||||||||||||||||||    
T  24717758 tgactttttggttatggtgtttagtttttattggtt 24717723  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 69; E-Value: 5e-31
Query Start/End: Original strand, 1 - 156
Target Start/End: Original strand, 43047989 - 43048145
Alignment:
Q  1 tttggtaggtttgatggttattttataggggttttgcaatggtttgccacaagatttgtttctgctattgcacagacgtttagactttggtttttggaga 100  Q
    ||||||||||||||||||||||||  | || |||||||| |||||  |||||||||||||| ||||||||| |   | ||||||||||||||||||||||    
T  43047989 tttggtaggtttgatggttattttggatggattttgcaacggttttacacaagatttgtttatgctattgctcgtgcatttagactttggtttttggaga 43048088  T
Q  101 tgac-ttttgggtctggtgtttagtttttattggttccaggggccctaagtggaggg 156  Q
    |||| |||| | ||| |||||||||||||||||||| | |||||||| ||| |||||    
T  43048089 tgacttttttgttctagtgtttagtttttattggtttcgggggccctcagtagaggg 43048145  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 1 - 135
Target Start/End: Original strand, 21590828 - 21590962
Alignment:
Q  1 tttggtaggtttgatggttattttataggggttttgcaatggtttgccacaagatttgtttctgctattgcacagacgtttagactttggtttttggaga 100  Q
    ||||||||||||| ||||||||||  || | |||| | | |||||| ||||||||||||||||||||||||||| ||||||||| |||| ||||||||||    
T  21590828 tttggtaggtttgttggttattttggagagatttttctacggtttggcacaagatttgtttctgctattgcacaaacgtttagaatttgttttttggaga 21590927  T
Q  101 tgacttttgggtctggtgtttagtttttattggtt 135  Q
    |||||| | | | ||||||||| ||||||||||||    
T  21590928 tgacttcttgatttggtgtttaatttttattggtt 21590962  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 1 - 156
Target Start/End: Complemental strand, 32979071 - 32978916
Alignment:
Q  1 tttggtaggtttgatggttattttataggggttttgcaatggtttgccacaagatttgtttctgctattgcacagacgtttagactttggtttttggaga 100  Q
    |||||| |||||||||||||||||  || ||||||  ||  ||||| |||||||||||||| ||  ||||| ||| ||||| ||||||||||||||||||    
T  32979071 tttggtgggtttgatggttattttggagaggttttttaacagtttggcacaagatttgtttatgtcattgcgcaggcgtttggactttggtttttggaga 32978972  T
Q  101 tgacttttgggtctggtgtttagtttttattggttccaggggccctaagtggaggg 156  Q
    |||||| | ||| | ||||||||||||||||| || || |||| || |||||||||    
T  32978971 tgacttcttggtttagtgtttagtttttattgatttcaagggcgctcagtggaggg 32978916  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #5
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 1 - 93
Target Start/End: Complemental strand, 26711978 - 26711885
Alignment:
Q  1 tttggtaggtttgatggttattttataggggttttgcaatggtttgccac-aagatttgtttctgctattgcacagacgtttagactttggttt 93  Q
    ||||||||||||||||||||||||| |||| |||| ||| |||||| ||| |||||||||||| |||||||||| | ||||| || ||||||||    
T  26711978 tttggtaggtttgatggttattttagagggatttttcaacggtttggcactaagatttgtttccgctattgcacggccgtttcgattttggttt 26711885  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 75; Significance: 1e-34; HSPs: 6)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 1 - 135
Target Start/End: Complemental strand, 45872976 - 45872842
Alignment:
Q  1 tttggtaggtttgatggttattttataggggttttgcaatggtttgccacaagatttgtttctgctattgcacagacgtttagactttggtttttggaga 100  Q
    ||||||||||||| ||||||||||  ||  ||||||||| |||||   ||||||||||||||||||||||| ||  ||||||||||||||||||||||||    
T  45872976 tttggtaggtttggtggttattttggagacgttttgcaacggtttcgtacaagatttgtttctgctattgcgcatgcgtttagactttggtttttggaga 45872877  T
Q  101 tgacttttgggtctggtgtttagtttttattggtt 135  Q
    |||||| ||||| |||||| |||||||||||||||    
T  45872876 tgacttatgggtttggtgtctagtttttattggtt 45872842  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 57; E-Value: 7e-24
Query Start/End: Original strand, 1 - 132
Target Start/End: Complemental strand, 52635495 - 52635364
Alignment:
Q  1 tttggtaggtttgatggttattttataggggttttgcaatggtttgccacaagatttgtttctgctattgcacagacgtttagactttggtttttggaga 100  Q
    ||||||||||||||||||||||||  |||  |||||||| | |||| |||||||||||||||||||||||  | || ||||||||||| ||||||||| |    
T  52635495 tttggtaggtttgatggttattttggagga-ttttgcaacgatttggcacaagatttgtttctgctattgagcggatgtttagactttagtttttggaaa 52635397  T
Q  101 tgactt-ttgggtctggtgtttagtttttattg 132  Q
    |||||| || | | |||||||||||||||||||    
T  52635396 tgacttcttagttttggtgtttagtttttattg 52635364  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 56 - 144
Target Start/End: Complemental strand, 55728446 - 55728357
Alignment:
Q  56 ttgtttctgctattgcacagacgtttagactttggtttttggagatgactt-ttgggtctggtgtttagtttttattggttccaggggcc 144  Q
    |||||||||||||||| | |  ||||||||||| ||||||||||||||||| |||| | |||||||||||||||||||||| ||||||||    
T  55728446 ttgtttctgctattgcgcgggtgtttagactttagtttttggagatgacttcttggttttggtgtttagtttttattggtttcaggggcc 55728357  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 78 - 135
Target Start/End: Complemental strand, 12130392 - 12130335
Alignment:
Q  78 gtttagactttggtttttggagatgacttttgggtctggtgtttagtttttattggtt 135  Q
    ||||||||||||||||||||||||||||| | ||| ||||||||||||||||||||||    
T  12130392 gtttagactttggtttttggagatgacttattggtttggtgtttagtttttattggtt 12130335  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 3 - 133
Target Start/End: Original strand, 42677894 - 42678024
Alignment:
Q  3 tggtaggtttgatggttattttataggggttttgcaatggtttgccacaagatttgtttctgctattgcacagacgtttagactttggtttttggagatg 102  Q
    |||||||||| |||||||||||  || |||||| |||  |||||  ||||||||| ||| || |||||  ||| ||||||||||||||||||  ||||||    
T  42677894 tggtaggtttcatggttattttgaagaggtttttcaacagtttggtacaagatttttttatgttattgtgcaggcgtttagactttggttttgagagatg 42677993  T
Q  103 acttttgggtctggtgtttagtttttattgg 133  Q
    |||| | ||| || |||||| ||||||||||    
T  42677994 acttcttggtttgatgtttaatttttattgg 42678024  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #6
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 77 - 135
Target Start/End: Complemental strand, 14440978 - 14440920
Alignment:
Q  77 cgtttagactttggtttttggagatgacttttgggtctggtgtttagtttttattggtt 135  Q
    |||| ||||||||||||||| ||||||||| | ||| ||||||||||||||||||||||    
T  14440978 cgttcagactttggtttttgaagatgacttcttggtttggtgtttagtttttattggtt 14440920  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 73; Significance: 2e-33; HSPs: 5)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 1 - 153
Target Start/End: Original strand, 46743178 - 46743330
Alignment:
Q  1 tttggtaggtttgatggttattttataggggttttgcaatggtttgccacaagatttgtttctgctattgcacagacgtttagactttggtttttggaga 100  Q
    ||||||||||||||||||||||||  |  ||||||  ||||||||| |||||||||||||||||||||||| | | ||||| ||||||||||||| ||||    
T  46743178 tttggtaggtttgatggttattttggataggttttttaatggtttggcacaagatttgtttctgctattgcgcgggcgtttggactttggtttttagaga 46743277  T
Q  101 tgacttttgggtctggtgtttagtttttattggttccaggggccctaagtgga 153  Q
    |||||| | ||| || ||||||||||||||||||| |  ||||||| ||||||    
T  46743278 tgacttcttggtttgatgtttagtttttattggtttcgagggccctcagtgga 46743330  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 42 - 144
Target Start/End: Original strand, 52984642 - 52984745
Alignment:
Q  42 gtttgccacaagatttgtttctgctattgcacagacgtttagactttggtttttggagatgactt-ttgggtctggtgtttagtttttattggttccagg 140  Q
    ||||| |||||||||||||||||||||||| | |  ||||||||||| ||||||| ||||||||| |||| | |||||||||||||||| ||||| ||||    
T  52984642 gtttggcacaagatttgtttctgctattgcgcgggtgtttagactttagtttttgcagatgacttcttggttttggtgtttagtttttaatggtttcagg 52984741  T
Q  141 ggcc 144  Q
    ||||    
T  52984742 ggcc 52984745  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 1 - 108
Target Start/End: Complemental strand, 31699048 - 31698941
Alignment:
Q  1 tttggtaggtttgatggttattttataggggttttgcaatggtttgccacaagatttgtttctgctattgcacagacgtttagactttggtttttggaga 100  Q
    ||||||||| || |||||||||||  | |||||||||||  ||||| ||||||| |||||| || ||||||  || | ||||||||||||||||||||||    
T  31699048 tttggtaggattcatggttattttggatgggttttgcaacagtttgacacaagacttgtttatgttattgcttaggcatttagactttggtttttggaga 31698949  T
Q  101 tgactttt 108  Q
    | ||||||    
T  31698948 ttactttt 31698941  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 58 - 135
Target Start/End: Original strand, 52991648 - 52991725
Alignment:
Q  58 gtttctgctattgcacagacgtttagactttggtttttggagatgacttttgggtctggtgtttagtttttattggtt 135  Q
    |||||| ||||||| | | ||||||||||||| |||||||||||||||| | ||| ||||||||||| | ||||||||    
T  52991648 gtttcttctattgcgcgggcgtttagactttgatttttggagatgacttcttggtttggtgtttagtctctattggtt 52991725  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #5
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 30 - 67
Target Start/End: Complemental strand, 31625726 - 31625689
Alignment:
Q  30 ggttttgcaatggtttgccacaagatttgtttctgcta 67  Q
    |||||||||||| |||| ||||||||||||||||||||    
T  31625726 ggttttgcaatgatttggcacaagatttgtttctgcta 31625689  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0974 (Bit Score: 65; Significance: 1e-28; HSPs: 1)
Name: scaffold0974
Description:

Target: scaffold0974; HSP #1
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 1 - 132
Target Start/End: Original strand, 2704 - 2836
Alignment:
Q  1 tttggtaggtttgatggttattttataggggttttgcaatggtttgccacaagatttgtttctgctattgcacagacgtttagactttggtttttggaga 100  Q
    ||||||||| |||||| |||||||| | ||| ||||||| |||||| ||||||| |||||||||||||||| ||| |||||||||||||| |||||||||    
T  2704 tttggtaggattgatgattattttagatgggatttgcaacggtttggcacaagacttgtttctgctattgctcaggcgtttagactttgggttttggaga 2803  T
Q  101 tg-acttttgggtctggtgtttagtttttattg 132  Q
    || | |||||| | | |||||||||||||||||    
T  2804 tgaatttttggttatagtgtttagtttttattg 2836  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 60; Significance: 1e-25; HSPs: 5)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 1 - 135
Target Start/End: Original strand, 3763288 - 3763423
Alignment:
Q  1 tttggtaggtttgatggttattttataggggttttgcaatggtttgccacaagatttgtttctgctattgcacagacgtttagactttggtttttggaga 100  Q
    ||||||||| |||||| |||||||  | | |||||||||||||||| ||||||| |||||||||||||||| |||  ||||| |||||| ||||||||||    
T  3763288 tttggtaggattgatgattattttggatgagttttgcaatggtttggcacaagacttgtttctgctattgctcaggtgtttaaactttgatttttggaga 3763387  T
Q  101 tgac-ttttgggtctggtgtttagtttttattggtt 135  Q
    |||| |||||| |  | |||||||||||||||||||    
T  3763388 tgactttttggttaagatgtttagtttttattggtt 3763423  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 32 - 135
Target Start/End: Original strand, 39580374 - 39580477
Alignment:
Q  32 ttttgcaatggtttgccacaagatttgtttctgctattgcacagacgtttagactttggtttttggagatgacttttgggtctggtgtttagtttttatt 131  Q
    |||| ||| |||||| |||||||||||||| ||||||||  |||||||||||||||||||||||||||||||||| | ||| | ||||||||||| ||||    
T  39580374 tttttcaacggtttgacacaagatttgtttatgctattgtgcagacgtttagactttggtttttggagatgacttcttggtttagtgtttagtttatatt 39580473  T
Q  132 ggtt 135  Q
    ||||    
T  39580474 ggtt 39580477  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 57; E-Value: 7e-24
Query Start/End: Original strand, 1 - 156
Target Start/End: Complemental strand, 5515132 - 5514976
Alignment:
Q  1 tttggtaggtttgatggttattttataggggttttgcaatggtttgccacaagatttgtttctgctattgcacagacgtttagactttggtttttggaga 100  Q
    ||||||||| ||||||||||||||  | || ||||||||  ||||| ||||||| |||||||| ||||||| ||| | |||||| |||||||||||||||    
T  5515132 tttggtaggattgatggttattttggatggattttgcaacagtttggcacaagacttgtttctactattgctcaggcatttagaatttggtttttggaga 5515033  T
Q  101 tgac-ttttgggtctggtgtttagtttttattggttccaggggccctaagtggaggg 156  Q
    |||| |||||| |  | |||||| ||||||||||||   |||||||| |||||||||    
T  5515032 tgactttttggttacgatgtttaatttttattggtttggggggccctcagtggaggg 5514976  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 1 - 135
Target Start/End: Original strand, 15050331 - 15050463
Alignment:
Q  1 tttggtaggtttgatggttattttataggggttttgcaatggtttgccacaagatttgtttctgctattgcacagacgtttagactttggtttttggaga 100  Q
    ||||||||||||||||||||||  | |||  |||| ||| ||| || ||||||||||||||||||||||||  || ||||||||||||| |||||  |||    
T  15050331 tttggtaggtttgatggttattggagagg--tttttcaacggtatgacacaagatttgtttctgctattgcgtaggcgtttagactttgatttttttaga 15050428  T
Q  101 tgacttttgggtctggtgtttagtttttattggtt 135  Q
    ||| || | ||| ||||||||||| | ||||||||    
T  15050429 tgatttcttggtttggtgtttagtctctattggtt 15050463  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #5
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 1 - 135
Target Start/End: Complemental strand, 10181915 - 10181781
Alignment:
Q  1 tttggtaggtttgatggttattttataggggttttgcaatggtttgccacaagatttgtttctgctattgcacagacgtttagactttggtttttggaga 100  Q
    ||||||||||||||||| ||||||  || ||||||  || |||||| |||| ||||||||| ||||||| | ||| ||||| | ||||  ||||||||||    
T  10181915 tttggtaggtttgatggctattttggagaggttttttaacggtttggcacatgatttgtttatgctatttcccagtcgtttggtctttaatttttggaga 10181816  T
Q  101 tgacttttgggtctggtgtttagtttttattggtt 135  Q
    |||||| | ||| ||  ||||||||||||||||||    
T  10181815 tgacttcttggtttgaagtttagtttttattggtt 10181781  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0083 (Bit Score: 53; Significance: 2e-21; HSPs: 1)
Name: scaffold0083
Description:

Target: scaffold0083; HSP #1
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 42 - 131
Target Start/End: Complemental strand, 2958 - 2867
Alignment:
Q  42 gtttgccacaagatttgtttctgctattgcacagacgt--ttagactttggtttttggagatgacttttgggtctggtgtttagtttttatt 131  Q
    ||||| |||||||||||||||||||||||||| | |||  |||||||||||||||||||||||| |||| ||| ||||||||| ||||||||    
T  2958 gtttggcacaagatttgtttctgctattgcacgggcgtgtttagactttggtttttggagatgaatttttggtatggtgtttaatttttatt 2867  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University