View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17737_low_74 (Length: 201)

Name: NF17737_low_74
Description: NF17737
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17737_low_74
NF17737_low_74
[»] chr8 (1 HSPs)
chr8 (17-185)||(40728817-40728985)
[»] chr4 (1 HSPs)
chr4 (9-91)||(50841894-50841976)


Alignment Details
Target: chr8 (Bit Score: 161; Significance: 4e-86; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 161; E-Value: 4e-86
Query Start/End: Original strand, 17 - 185
Target Start/End: Complemental strand, 40728985 - 40728817
Alignment:
Q  17 agaatagggttgggacggaaaagcctgaacggcgaaaaatttggagaaagaatgattcttcgagtgatagtgagagtgagagtgaagtggaatcaaagaa 116  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||    
T  40728985 agaatagggttgggacggaaaagcctgaacggcgaaaaatttggagaaagaatgattcttcgagtgatagtgatagtgagagtgaagtggaatcaaagaa 40728886  T
Q  117 tgagggatactattctaaggtgggtagtattgctgctttggggaaatatgatgtgaagagggtgaggag 185  Q
    |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  40728885 tgaggggtactattctaaggtgggtagtattgctgctttggggaaatatgatgtgaagagggtgaggag 40728817  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 47; Significance: 5e-18; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 9 - 91
Target Start/End: Complemental strand, 50841976 - 50841894
Alignment:
Q  9 gagtgagaagaatagggttgggacggaaaagcctgaacggcgaaaaatttggagaaagaatgattcttcgagtgatagtgaga 91  Q
    |||||| ||||| ||||||||| |  ||||||||||| || ||||||||||||| |||||||||||||| |||||||||||||    
T  50841976 gagtgataagaagagggttggggcaaaaaagcctgaaaggagaaaaatttggaggaagaatgattcttctagtgatagtgaga 50841894  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University