View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17737_low_65 (Length: 215)

Name: NF17737_low_65
Description: NF17737
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17737_low_65
NF17737_low_65
[»] chr4 (1 HSPs)
chr4 (18-200)||(47569047-47569229)


Alignment Details
Target: chr4 (Bit Score: 163; Significance: 3e-87; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 18 - 200
Target Start/End: Original strand, 47569047 - 47569229
Alignment:
Q  18 caaattaatttgatgtccccccactctgataccatacacatgtagttccattttttgaattattaccggtattttcttgttgggaaaaacatgcaatact 117  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  47569047 caaattaatttgatgtccccccactctgataccatacacatgtagttccattttttgaattattaccggtattttcttgttgggaaaaacatgcaatact 47569146  T
Q  118 gatctaaatatgtttatagtttgcacatccttaggtttggctttcttaggtttaccaattcattaatcttaagagtacctttg 200  Q
    |||||||||||||||| ||||||||||||||||| |||| ||||||||||||||||||||||| |||||||||||| ||||||    
T  47569147 gatctaaatatgtttagagtttgcacatccttagttttgactttcttaggtttaccaattcataaatcttaagagtgcctttg 47569229  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University