View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17737_high_47 (Length: 240)

Name: NF17737_high_47
Description: NF17737
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17737_high_47
NF17737_high_47
[»] chr1 (2 HSPs)
chr1 (127-224)||(15710508-15710604)
chr1 (15-76)||(15710868-15710929)


Alignment Details
Target: chr1 (Bit Score: 82; Significance: 8e-39; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 82; E-Value: 8e-39
Query Start/End: Original strand, 127 - 224
Target Start/End: Complemental strand, 15710604 - 15710508
Alignment:
Q  127 gaccatagcaacaatcttagactaagatggcgcagaacaaagcaaacacagtgtcacagcttcaagctttgaagaacaagagtgggaagtcttataat 224  Q
    ||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||    
T  15710604 gaccatatcaacaatct-agactaagatggcgcagaacaaagcaaacacagtgtcacagcttcaatctttgaagaacaagagtgggaagtcttataat 15710508  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 15 - 76
Target Start/End: Complemental strand, 15710929 - 15710868
Alignment:
Q  15 aatgtcactaaaaaatgcattattttggaaatgttaaatgaaatttcaaatatttttataga 76  Q
    ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||    
T  15710929 aatgtcactaaaaaatgcattcttttggaaatgttaaatgaaatttcaaatatttttataga 15710868  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University