View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17734_high_35 (Length: 232)

Name: NF17734_high_35
Description: NF17734
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17734_high_35
NF17734_high_35
[»] chr7 (1 HSPs)
chr7 (10-217)||(31933762-31933974)


Alignment Details
Target: chr7 (Bit Score: 105; Significance: 1e-52; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 105; E-Value: 1e-52
Query Start/End: Original strand, 10 - 217
Target Start/End: Original strand, 31933762 - 31933974
Alignment:
Q  10 gatatgaaattcgcacccaaacctgcatttagaggggatgagtttccaagtcccgccccaacccccacccgcgtcactgtcgt---aaaataatcannnn 106  Q
    ||||| ||||| |||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||   |||| |||||        
T  31933762 gatatcaaatttgcacccaaacctgcatttagaggggatgagtttccaagccccgccccaa-ccccacccgcgtcactgtcgtaaaaaaaaaatcaattt 31933860  T
Q  107 nnnccacatcaacaaaaaatatcnnnnnnnnaagcggcaaaaatcttattatgctaagccaatgagagggacactgtgcatgca---ctttcctttcttt 203  Q
       ||||||||||||||||||||        |||||||||||||||||||||||||||||||||||||||||||||||| ||||   | || ||||||||    
T  31933861 tttccacatcaacaaaaaatatcttttttttaagcggcaaaaatcttattatgctaagccaatgagagggacactgtgcttgcatttcctttctttcttt 31933960  T
Q  204 ctctttaggtgagt 217  Q
    ||||||||||||||    
T  31933961 ctctttaggtgagt 31933974  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University