View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17734_high_27 (Length: 269)

Name: NF17734_high_27
Description: NF17734
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17734_high_27
NF17734_high_27
[»] chr1 (1 HSPs)
chr1 (167-250)||(3581518-3581601)


Alignment Details
Target: chr1 (Bit Score: 84; Significance: 5e-40; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 84; E-Value: 5e-40
Query Start/End: Original strand, 167 - 250
Target Start/End: Complemental strand, 3581601 - 3581518
Alignment:
Q  167 catagaaaaggataattttctaaggaagattggtttctaatatctatgttacagttgcagggcacaattccatgaccacctgcc 250  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  3581601 catagaaaaggataattttctaaggaagattggtttctaatatctatgttacagttgcagggcacaattccatgaccacctgcc 3581518  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University