View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1772_low_21 (Length: 208)

Name: NF1772_low_21
Description: NF1772
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1772_low_21
NF1772_low_21
[»] scaffold0179 (2 HSPs)
scaffold0179 (1-108)||(6463-6570)
scaffold0179 (166-195)||(6629-6658)


Alignment Details
Target: scaffold0179 (Bit Score: 72; Significance: 6e-33; HSPs: 2)
Name: scaffold0179
Description:

Target: scaffold0179; HSP #1
Raw Score: 72; E-Value: 6e-33
Query Start/End: Original strand, 1 - 108
Target Start/End: Original strand, 6463 - 6570
Alignment:
Q  1 ccattcctctcctttatcctctaggataattttttgtcgtctccttttcgcttactaatctttttatagactctatcaatgaatccaccactctcaacac 100  Q
    |||| |||||||||| |||||||||||| ||||||  | ||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||    
T  6463 ccatccctctcctttctcctctaggatattttttttccttctccttttcgcttattaatctttttatagactctatgaatgaatccaccactctcaacac 6562  T
Q  101 cctgaaaa 108  Q
    ||| ||||    
T  6563 cctcaaaa 6570  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0179; HSP #2
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 166 - 195
Target Start/End: Original strand, 6629 - 6658
Alignment:
Q  166 gggtgtttgattattggtgaatttgtgtct 195  Q
    ||||||||||||||||||||||||||||||    
T  6629 gggtgtttgattattggtgaatttgtgtct 6658  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University