View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1772_low_20 (Length: 210)

Name: NF1772_low_20
Description: NF1772
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1772_low_20
NF1772_low_20
[»] chr6 (1 HSPs)
chr6 (26-117)||(6732581-6732675)


Alignment Details
Target: chr6 (Bit Score: 69; Significance: 4e-31; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 26 - 117
Target Start/End: Original strand, 6732581 - 6732675
Alignment:
Q  26 agctattttgcttgcatcaccaattgcatgagatgcagaatctcaagatg---tatcaccaacttgtcagctgatttttcgtagggtataattat 117  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||   |   ||||||||||||||||||||||||||||||||||||||    
T  6732581 agctattttgcttgcatcaccaattgcatgagatgcagaatctcaagatgggttgctaccaacttgtcagctgatttttcgtagggtataattat 6732675  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University