View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1772_low_17 (Length: 236)

Name: NF1772_low_17
Description: NF1772
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1772_low_17
NF1772_low_17
[»] chr6 (2 HSPs)
chr6 (185-220)||(23922027-23922062)
chr6 (73-101)||(23921915-23921943)


Alignment Details
Target: chr6 (Bit Score: 32; Significance: 0.000000005; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 220
Target Start/End: Original strand, 23922027 - 23922062
Alignment:
Q  185 tagcaacttttctttctaaaattgccatgtaccttc 220  Q
    |||||||||||||||||||||||| |||||||||||    
T  23922027 tagcaacttttctttctaaaattgtcatgtaccttc 23922062  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 73 - 101
Target Start/End: Original strand, 23921915 - 23921943
Alignment:
Q  73 ttcaagattagtaactaacaattactatt 101  Q
    |||||||||||||||||||||||||||||    
T  23921915 ttcaagattagtaactaacaattactatt 23921943  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University