View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17723_high_29 (Length: 246)

Name: NF17723_high_29
Description: NF17723
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17723_high_29
NF17723_high_29
[»] chr4 (1 HSPs)
chr4 (1-229)||(54038472-54038703)


Alignment Details
Target: chr4 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 1 - 229
Target Start/End: Original strand, 54038472 - 54038703
Alignment:
Q  1 tagttgttgtcgcttaattgcggtgggcaacataaggtgtgggaacataagggaagccagtgtggtcaaactaagtcgtgtctaagtaaaagaagataga 100  Q
    |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  54038472 tagttgttgtcgtttaattgcggtgggcaacataaggtgtgggaacataagggaagccagtgtggtcaaactaagtcgtgtctaagtaaaagaagataga 54038571  T
Q  101 tgacaattggaaact---aaagaaaagaaagatagatgaaaataggaaactgtaagataaaattgagccatttaaacagcaaagtcaaactgtactgaaa 197  Q
    |||||||||||||||   ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  54038572 tgacaattggaaactgtaaaagaaaagaaagatagatgaaaataggaaactgtaagataaaattgagccatttaaacagcaaagtcaaactgtactgaaa 54038671  T
Q  198 acagtatgaaattcatgacataaagtaaaacc 229  Q
    ||||||||||||||||||||||||||||||||    
T  54038672 acagtatgaaattcatgacataaagtaaaacc 54038703  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University