View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17721_low_41 (Length: 237)

Name: NF17721_low_41
Description: NF17721
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17721_low_41
NF17721_low_41
[»] chr1 (1 HSPs)
chr1 (17-237)||(49921764-49921984)
[»] chr6 (1 HSPs)
chr6 (20-236)||(13799475-13799692)


Alignment Details
Target: chr1 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 17 - 237
Target Start/End: Complemental strand, 49921984 - 49921764
Alignment:
Q  17 aattggacggtggacttcttggcatccggtggaaagctcggctacggtacttaacgttgatggtagcagcttcggtaacccaggcatctctggctttgga 116  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||    
T  49921984 aattggacggtggacttcttggcatccggtggaaagctcggctacggtacttaacgttgatggtagtagcttcggtaacccaggcatctctggctttgga 49921885  T
Q  117 ggagttttacgaagacatgatgggtcgtggatatatggctttggaggaaacattggtttttcatccattcttcaggctgagttgctggctctttatcatg 216  Q
    || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  49921884 ggcgttttacgaagacatgatgggtcgtggatatatggctttggaggaaacattggtttttcatccattcttcaggctgagttgctggctctttatcatg 49921785  T
Q  217 gtttgcgagttgcgtgggatc 237  Q
    ||||| ||||||||| |||||    
T  49921784 gtttgtgagttgcgtaggatc 49921764  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 110; Significance: 1e-55; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 110; E-Value: 1e-55
Query Start/End: Original strand, 20 - 236
Target Start/End: Original strand, 13799475 - 13799692
Alignment:
Q  20 tggacggtggacttcttggcatccggtggaaagctcggctacggtacttaacgttgatggtagcagcttcggtaacccaggcatctctgg-ctttggagg 118  Q
    |||||| |||||||||||||| ||| |||| |||||||||||||| ||||| ||||||||||||||||||||||||||||||||||| ||  |||  |||    
T  13799475 tggacgatggacttcttggcacccgatggagagctcggctacggtgcttaatgttgatggtagcagcttcggtaacccaggcatctccggtttttttagg 13799574  T
Q  119 agttttacgaagacatgatgggtcgtggatatatggctttggaggaaacattggtttttcatccattcttcaggctgagttgctggctctttatcatggt 218  Q
    ||||||| |||| |||||||| || |||||||| || |||||||| || |||||| || |||||||||||||||  |||||||||||| ||||||||||     
T  13799575 agttttaagaaggcatgatggctcttggatatacgggtttggagggaaaattggtattgcatccattcttcaggtggagttgctggctatttatcatggg 13799674  T
Q  219 ttgcgagttgcgtgggat 236  Q
    || |||||||||||||||    
T  13799675 ttacgagttgcgtgggat 13799692  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University