View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17721_high_36 (Length: 245)

Name: NF17721_high_36
Description: NF17721
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17721_high_36
NF17721_high_36
[»] chr7 (1 HSPs)
chr7 (24-236)||(45714379-45714587)


Alignment Details
Target: chr7 (Bit Score: 144; Significance: 8e-76; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 144; E-Value: 8e-76
Query Start/End: Original strand, 24 - 236
Target Start/End: Complemental strand, 45714587 - 45714379
Alignment:
Q  24 gtctctatcgttgccctatgttgcttcccgtcactgtagcaacatcttacagacagacttcaggtcattccacagctagcttgatatatagcaaccacaa 123  Q
    |||||||||| ||||||||||||||||||||| |||||||| |||| |||||||    |||||  ||||||||| |||||||| ||||||||||||||||    
T  45714587 gtctctatcgctgccctatgttgcttcccgtctctgtagcagcatcctacagac----ttcagtccattccacaactagcttggtatatagcaaccacaa 45714492  T
Q  124 ttttatgtcaaacaatttcagtaacaccgtttggatttgatgcattaattacgtcacatatgtaaaataacagacaatctcaccgtttatgcaaaatcca 223  Q
    ||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||| ||||||||||||| ||||||||||||||||    
T  45714491 ttttatgtcaaacaatttcagtaacaccgtttgtatttgatgcattaactacgtcacatatgtaaaataccagacaatctcactgtttatgcaaaatcca 45714392  T
Q  224 ctctcagaataat 236  Q
    |||||| ||||||    
T  45714391 ctctcaaaataat 45714379  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University