View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17716_low_83 (Length: 250)

Name: NF17716_low_83
Description: NF17716
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17716_low_83
NF17716_low_83
[»] chr5 (1 HSPs)
chr5 (1-234)||(8375704-8375937)
[»] chr8 (1 HSPs)
chr8 (206-238)||(18145631-18145663)


Alignment Details
Target: chr5 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 1 - 234
Target Start/End: Original strand, 8375704 - 8375937
Alignment:
Q  1 ctgcaaaagtacttgcaaccggcgtctatattgcttgcaactcaggactgttttgtgcgaccgggacattacgggtagcaacaagtgattcaacaatatg 100  Q
    |||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||    
T  8375704 ctgcaaaagtacttgcaaccggtgtctatattgcttgcaactcgggactgttttgtgcgaccgtgacattaggggtagcaacaagtgattcaacaatatg 8375803  T
Q  101 ttcttcttttgttgcagttgctgaatcaatagcttcaaatgcattagaagaaccaacaccagaagaatttcctttaataggcaccaaatctagcttacta 200  Q
     |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||    
T  8375804 ctcttcttttgttgcagttgccgaatcaatagcttcaaatgcattagaagaaccaacaccaaaagaattttctttaataggcaccaaatctagcttacta 8375903  T
Q  201 gttggtatttgcttcttgccctttatagcatttt 234  Q
    ||||||||||||||||||||||||||||||||||    
T  8375904 gttggtatttgcttcttgccctttatagcatttt 8375937  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 206 - 238
Target Start/End: Original strand, 18145631 - 18145663
Alignment:
Q  206 tatttgcttcttgccctttatagcattttcctt 238  Q
    |||||||||||||||||||||| ||||||||||    
T  18145631 tatttgcttcttgccctttataacattttcctt 18145663  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University