View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17716_low_77 (Length: 267)

Name: NF17716_low_77
Description: NF17716
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17716_low_77
NF17716_low_77
[»] chr8 (2 HSPs)
chr8 (7-72)||(32955502-32955567)
chr8 (206-263)||(32955307-32955364)


Alignment Details
Target: chr8 (Bit Score: 62; Significance: 7e-27; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 7 - 72
Target Start/End: Complemental strand, 32955567 - 32955502
Alignment:
Q  7 cttgcttaagaatatggaaagagaattggataattctatttctatacatgttcttaacttcaatta 72  Q
    |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||    
T  32955567 cttgcttaagaatatggaaagagaattggataattctatttctatatatgttcttaacttcaatta 32955502  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 206 - 263
Target Start/End: Complemental strand, 32955364 - 32955307
Alignment:
Q  206 tattgatagtactattttagattggctatgaccatatatgaaatatccctttgctact 263  Q
    ||||||||||||| ||||||||||||||||||||||| ||||||||||||||| ||||    
T  32955364 tattgatagtactcttttagattggctatgaccatatgtgaaatatccctttgatact 32955307  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University