View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17716_low_74 (Length: 290)

Name: NF17716_low_74
Description: NF17716
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17716_low_74
NF17716_low_74
[»] chr7 (1 HSPs)
chr7 (1-265)||(46287503-46287770)


Alignment Details
Target: chr7 (Bit Score: 226; Significance: 1e-124; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 226; E-Value: 1e-124
Query Start/End: Original strand, 1 - 265
Target Start/End: Complemental strand, 46287770 - 46287503
Alignment:
Q  1 cgatgatatttatgtcttagggtaacatcggtggaagaaaaattagggagaagaaaactatttgagaggctgtgggttttccaaaactggaactattaaa 100  Q
    ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||    
T  46287770 cgatgatatttatgtcttagggtaacatcggtgaaagaaaaattagggagaagaaaactatttgagaggttgtgggttttccaaaactggaactattaaa 46287671  T
Q  101 tttggggttgaatttttattatctttatatgtagtcatgacatgacatctatgttggcaagtagccagggtaatttgcacattccagccagctatattaa 200  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||    
T  46287670 tttggggttgaatttttattatctttatatgtagtcatgacatgacatctatgttggcaagtagccagggtaatttgcacattccagccaactatattaa 46287571  T
Q  201 attggtaatttgatttataat---aatagccatctttaactatggatggttaaatatggagcaaatag 265  Q
    |||||||||||||||||||||   ||||||||||||||||  ||||||||||||||| || |||||||    
T  46287570 attggtaatttgatttataataataatagccatctttaacgttggatggttaaatattgaacaaatag 46287503  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University