View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17716_low_108 (Length: 205)

Name: NF17716_low_108
Description: NF17716
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17716_low_108
NF17716_low_108
[»] chr3 (1 HSPs)
chr3 (19-153)||(48372721-48372855)


Alignment Details
Target: chr3 (Bit Score: 99; Significance: 5e-49; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 99; E-Value: 5e-49
Query Start/End: Original strand, 19 - 153
Target Start/End: Complemental strand, 48372855 - 48372721
Alignment:
Q  19 aatatggtactgaatgggattggggagcaatttcatttcatgcatgaaaaccaacattatttcttaaccctgtatttgactctcatattaaatttttcat 118  Q
    |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||    
T  48372855 aatatggtactgaatgggattggggagcaatttcatttcatgtatgaaaaccaacattattttttaaccctgtatttgactctcatattaaatttttcat 48372756  T
Q  119 ttgaatnnnnnnnngaattaaatgaataagggaat 153  Q
    ||||||        |||||||||||||||| ||||    
T  48372755 ttgaatgaaaaaaagaattaaatgaataagtgaat 48372721  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University