View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17715_low_15 (Length: 209)

Name: NF17715_low_15
Description: NF17715
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17715_low_15
NF17715_low_15
[»] chr5 (2 HSPs)
chr5 (80-194)||(36942413-36942527)
chr5 (18-84)||(36936326-36936392)


Alignment Details
Target: chr5 (Bit Score: 111; Significance: 3e-56; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 111; E-Value: 3e-56
Query Start/End: Original strand, 80 - 194
Target Start/End: Original strand, 36942413 - 36942527
Alignment:
Q  80 tgacccatgagtgtagctttgataatggagagagggaggttttcaatgaggatatgtggttgagaggttgttgtttgtgatggcgatcgctgggcattgt 179  Q
    ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  36942413 tgacccatgagtgtagctttgataatggagagagggatgttttcaatgaggatatgtggttgagaggttgttgtttgtgatggcgatcgctgggcattgt 36942512  T
Q  180 ggtgtttaatctgtg 194  Q
    |||||||||||||||    
T  36942513 ggtgtttaatctgtg 36942527  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 63; E-Value: 1e-27
Query Start/End: Original strand, 18 - 84
Target Start/End: Original strand, 36936326 - 36936392
Alignment:
Q  18 atttctacccggatttagactggagaagtatatctttcctaggagttgggcgtttgggattctgacc 84  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||    
T  36936326 atttctacccggatttagactggagaagtatatctttcctaggagttgggcatttgggattctgacc 36936392  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University