View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17714_high_10 (Length: 237)

Name: NF17714_high_10
Description: NF17714
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17714_high_10
NF17714_high_10
[»] chr4 (2 HSPs)
chr4 (88-162)||(53258148-53258222)
chr4 (188-217)||(53258248-53258277)


Alignment Details
Target: chr4 (Bit Score: 75; Significance: 1e-34; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 88 - 162
Target Start/End: Original strand, 53258148 - 53258222
Alignment:
Q  88 tagtaatttaattgagttttaccctaagatctaagtctccttcagtggaaggcattgttgtctttgataaaagag 162  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  53258148 tagtaatttaattgagttttaccctaagatctaagtctccttcagtggaaggcattgttgtctttgataaaagag 53258222  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 188 - 217
Target Start/End: Original strand, 53258248 - 53258277
Alignment:
Q  188 gttttagatctatctaatgctaatgcttta 217  Q
    ||||||||||||||||||||||||||||||    
T  53258248 gttttagatctatctaatgctaatgcttta 53258277  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University