View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17713_low_12 (Length: 224)

Name: NF17713_low_12
Description: NF17713
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17713_low_12
NF17713_low_12
[»] chr6 (1 HSPs)
chr6 (19-212)||(1877054-1877247)


Alignment Details
Target: chr6 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 19 - 212
Target Start/End: Original strand, 1877054 - 1877247
Alignment:
Q  19 agaggttacctacccacgacaatctagcgaaaagaggtattttgagtggtagctcggatgttgatttgattgtgtttggtgcatgcccaggttatagaga 118  Q
    |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  1877054 agaggttacctatccacgacaatctagcgaaaagaggtattttgagtggtagctcggatgttgatttgattgtgtttggtgcatgcccaggttatagaga 1877153  T
Q  119 ggtggaggatggtttattttgttggtagctcgaaggtggattgctagtttcatttggtatcatatttttctgttagtgggaacgagtataatct 212  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||    
T  1877154 ggtggaggatggtttattttgttggtagctcgaaggtggattgctagtttcatttggtatcatatttttctgttagtgggaacgagtgtaatct 1877247  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University