View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17712_low_29 (Length: 239)

Name: NF17712_low_29
Description: NF17712
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17712_low_29
NF17712_low_29
[»] chr1 (1 HSPs)
chr1 (1-221)||(2127161-2127383)


Alignment Details
Target: chr1 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 2127161 - 2127383
Alignment:
Q  1 ttggatttttctccaccttcttgcatacgaaaacttcacggtcagagtccacgaaggggacccctaggcttgtagtaatagtagaatcttttatatccaa 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  2127161 ttggatttttctccaccttcttgcatacgaaaacttcacggtcagagtccacgaaggggacccctaggcttgtagtaatagtagaatcttttatatccaa 2127260  T
Q  101 tatatggcggcagatgatacnnnnnnncattttataattcatcaatacaaacaacaagattttgtaaataaagcaaaataagatttcatattcat--ata 198  Q
    ||||||||||||||||||||       |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||  |||    
T  2127261 tatatggcggcagatgatacaaaaaaacattttataattcatcaatacaaataacaagattttgtaaataaagcaaaataagatttcatattcatgaata 2127360  T
Q  199 tggggtacgaagagggaggaacg 221  Q
    |||||||||||||||||||||||    
T  2127361 tggggtacgaagagggaggaacg 2127383  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University