View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17708_high_8 (Length: 218)

Name: NF17708_high_8
Description: NF17708
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17708_high_8
NF17708_high_8
[»] chr1 (1 HSPs)
chr1 (10-197)||(32084629-32084816)


Alignment Details
Target: chr1 (Bit Score: 180; Significance: 2e-97; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 10 - 197
Target Start/End: Original strand, 32084629 - 32084816
Alignment:
Q  10 gaagcaaaggaggaacggtggcggggaaagaatcagaagccatggcggaaatgagggtggttttgccggcggatttgtcaccaacaatgacgattctaac 109  Q
    ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  32084629 gaagcaatggaggaacggtggcggggaaagaatcagaagccatggcggaaatgagggtggttttgccggcggatttgtcaccaacaatgacgattctaac 32084728  T
Q  110 ttccttgagaattgtggtgttgcggttattcgccattggaattggaattgagaaaacgagagaagaagggttttgtgtgattttgatt 197  Q
    ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  32084729 ttccttgagaattgtggtgttgcagttattcgccattggaattggaattgagaaaacgagagaagaagggttttgtgtgattttgatt 32084816  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University