View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17703_low_11 (Length: 219)

Name: NF17703_low_11
Description: NF17703
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17703_low_11
NF17703_low_11
[»] chr3 (1 HSPs)
chr3 (16-206)||(55074713-55074896)


Alignment Details
Target: chr3 (Bit Score: 123; Significance: 2e-63; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 123; E-Value: 2e-63
Query Start/End: Original strand, 16 - 206
Target Start/End: Complemental strand, 55074896 - 55074713
Alignment:
Q  16 gattcaattagtaagtatccaatatccaacaaaaacatgtgtgtgtccaccctgagtccctgatcttgatgattccagatccaaatgattttcacatnnn 115  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||| |        ||||||||||||||||||||||||||||||||||       
T  55074896 gattcaattagtaagtatccaatatccaacaaaaacatgtgtgtgtccaccctaa--------tcttgatgattccagatccaaatgattttcacataaa 55074805  T
Q  116 nnnnn-tgatgggatgaaatattaggaaagaatatatataaatgcaaagaattgttcaactctgattatcccaaagcaacaatgagaataat 206  Q
          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||    
T  55074804 aaaaaatgatgggatgaaatattaggaaagaatatatataaatgcaaagaattgttcaactctgattatgccaaagcaacaatgagaataat 55074713  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University