View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17699_low_18 (Length: 242)

Name: NF17699_low_18
Description: NF17699
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17699_low_18
NF17699_low_18
[»] chr1 (1 HSPs)
chr1 (1-200)||(10777843-10778043)


Alignment Details
Target: chr1 (Bit Score: 139; Significance: 7e-73; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 139; E-Value: 7e-73
Query Start/End: Original strand, 1 - 200
Target Start/End: Original strand, 10777843 - 10778043
Alignment:
Q  1 aaaaaatttgtataaattgaaatgaaaaattttgttttgtgatagctgggta-tgagacccttgatgtgatttagatgtgagctcgacaaaggttaatct 99  Q
    |||||| ||||||||||||||||||||||||||||||||||||||| ||||| ||||||||| |||||||||||||||||||||||||||||||||||||    
T  10777843 aaaaaagttgtataaattgaaatgaaaaattttgttttgtgatagcagggtaatgagaccctagatgtgatttagatgtgagctcgacaaaggttaatct 10777942  T
Q  100 ggtcctatgtatctttaatgatcttagagaattagagctaccnnnnnnngtgtatatttatctcttcnnnnnnnggatactaatggtaggagccacaacc 199  Q
    ||||||||||||||||||||||||||||||||||||||||||       ||||||||||||||||||       ||||||||||||||||||||||||||    
T  10777943 ggtcctatgtatctttaatgatcttagagaattagagctacctttttttgtgtatatttatctcttcaaaaaaaggatactaatggtaggagccacaacc 10778042  T
Q  200 c 200  Q
    |    
T  10778043 c 10778043  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University