View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17698_high_33 (Length: 238)

Name: NF17698_high_33
Description: NF17698
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17698_high_33
NF17698_high_33
[»] chr1 (1 HSPs)
chr1 (1-110)||(16646962-16647070)


Alignment Details
Target: chr1 (Bit Score: 94; Significance: 5e-46; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 94; E-Value: 5e-46
Query Start/End: Original strand, 1 - 110
Target Start/End: Complemental strand, 16647070 - 16646962
Alignment:
Q  1 caacgcaacatttgagtaacaatagcaatggaactgcaagtagttcgtatgaatatgagaatggggattgtgagtttgaagatgaggtgcatgagcatgt 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||    
T  16647070 caacgcaacatttgagtaacaatagcaatggaactgcaagtagttcgtatgaatatgagaat-gggattgttagtttgaagatgaggtgcatgagcatgt 16646972  T
Q  101 tttttaagaa 110  Q
    |||| |||||    
T  16646971 ttttgaagaa 16646962  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University