View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17683_low_2 (Length: 505)

Name: NF17683_low_2
Description: NF17683
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17683_low_2
NF17683_low_2
[»] chr2 (1 HSPs)
chr2 (20-164)||(4295598-4295742)
[»] chr4 (1 HSPs)
chr4 (227-257)||(41084850-41084880)


Alignment Details
Target: chr2 (Bit Score: 121; Significance: 9e-62; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 121; E-Value: 9e-62
Query Start/End: Original strand, 20 - 164
Target Start/End: Original strand, 4295598 - 4295742
Alignment:
Q  20 aaaatttgattgggttaagtgggatacaagtatcttgatcagaataatggtggtttaggtgctgatagagtttgaaagtttaatttatatttgttacgta 119  Q
    |||||||||||||||||||| ||||||||||||||||||| |||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||    
T  4295598 aaaatttgattgggttaagtaggatacaagtatcttgatcggaataacggtggtttaggagctgatagagtttgaaagtttaatttatatttgttacgta 4295697  T
Q  120 aatggcgttgaaggttgcatgtgggtcggtagattatggtttaaa 164  Q
    ||||| ||||||||||||| |||||||||||||||||||||||||    
T  4295698 aatggtgttgaaggttgcacgtgggtcggtagattatggtttaaa 4295742  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 31; Significance: 0.00000005; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 227 - 257
Target Start/End: Original strand, 41084850 - 41084880
Alignment:
Q  227 tgtgtggtggaaatatttgcttggtgttaga 257  Q
    |||||||||||||||||||||||||||||||    
T  41084850 tgtgtggtggaaatatttgcttggtgttaga 41084880  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University