View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17681_low_40 (Length: 214)

Name: NF17681_low_40
Description: NF17681
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17681_low_40
NF17681_low_40
[»] chr1 (1 HSPs)
chr1 (93-197)||(41126898-41127002)


Alignment Details
Target: chr1 (Bit Score: 105; Significance: 1e-52; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 105; E-Value: 1e-52
Query Start/End: Original strand, 93 - 197
Target Start/End: Complemental strand, 41127002 - 41126898
Alignment:
Q  93 gtatgttgagataatggcgtctgtttcttatatcagagaggaccagacaaataaatttacattcatctctctctagaagggtataaacctgcaatatgtg 192  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  41127002 gtatgttgagataatggcgtctgtttcttatatcagagaggaccagacaaataaatttacattcatctctctctagaagggtataaacctgcaatatgtg 41126903  T
Q  193 tattt 197  Q
    |||||    
T  41126902 tattt 41126898  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University