View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17681_low_21 (Length: 282)

Name: NF17681_low_21
Description: NF17681
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17681_low_21
NF17681_low_21
[»] chr1 (1 HSPs)
chr1 (21-271)||(39114413-39114663)


Alignment Details
Target: chr1 (Bit Score: 247; Significance: 1e-137; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 247; E-Value: 1e-137
Query Start/End: Original strand, 21 - 271
Target Start/End: Complemental strand, 39114663 - 39114413
Alignment:
Q  21 attggtaaccagctaatcgttgagagcatgcatgtatatgtggaggaggttgctaaacacttcgaaaaatgggaccatatatttgctaccattaatccaa 120  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||    
T  39114663 attggtaaccagctaatcgttgagagcatgcatgtatatgtggaggaggttgctaaacatttcgaaaaatgggaccatatatttgctaccattaatccaa 39114564  T
Q  121 acataccatggcatggctatggctacttgtctagtccaatccaactgtacgtacgttctttgattttgagagccatctattctcatatctgtcttggaaa 220  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  39114563 acataccatggcatggctatggctacttgtctagtccaatccaactgtacgtacgttctttgattttgagagccatctattctcatatctgtcttggaaa 39114464  T
Q  221 ctcttgacacagtcgcatatactatatacaatttgttcttgtctcattcat 271  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||    
T  39114463 ctcttgacacagtcgcatatactatatacaatttgttcttgtctcattcat 39114413  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University