View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1767_low_19 (Length: 226)

Name: NF1767_low_19
Description: NF1767
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1767_low_19
NF1767_low_19
[»] chr1 (1 HSPs)
chr1 (67-205)||(31960207-31960350)


Alignment Details
Target: chr1 (Bit Score: 104; Significance: 5e-52; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 104; E-Value: 5e-52
Query Start/End: Original strand, 67 - 205
Target Start/End: Complemental strand, 31960350 - 31960207
Alignment:
Q  67 tacaatggaatttgggaagtaagagaaatattatttttaataaaaaatttccatttcttgtttttgtta-----aagagtgctccaagaacatcgattaa 161  Q
    ||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||     ||||||||||||||||||||||||||    
T  31960350 tacaatggaatttggaaagtaagagaaatattatttttaataaaaaatttccattttttgtttttgttaaagctaagagtgctccaagaacatcgattaa 31960251  T
Q  162 tatgactcagaaaacaatagcacaaggtaagaaaagttaccgat 205  Q
    |||||| || ||||||||| ||||||||||||||||||||||||    
T  31960250 tatgacgcataaaacaatatcacaaggtaagaaaagttaccgat 31960207  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University