View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17676_low_36 (Length: 201)

Name: NF17676_low_36
Description: NF17676
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17676_low_36
NF17676_low_36
[»] chr1 (1 HSPs)
chr1 (72-192)||(4194990-4195110)


Alignment Details
Target: chr1 (Bit Score: 117; Significance: 8e-60; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 117; E-Value: 8e-60
Query Start/End: Original strand, 72 - 192
Target Start/End: Original strand, 4194990 - 4195110
Alignment:
Q  72 tagtagggcctagtttacctgattgacctgtccccacctaatgtgtcacaaaatcattacttcctacttacttccctccctacaaaaacaactcaaagca 171  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  4194990 tagtagggcctagtttacctgattgacctgtccccacctaatgtgtcacaaaatcattacttcctacttacttccctccctacaaaaacaactcaaagca 4195089  T
Q  172 ccacacacattctcacactct 192  Q
     ||||||||||||||||||||    
T  4195090 tcacacacattctcacactct 4195110  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University