View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17676_low_23 (Length: 318)

Name: NF17676_low_23
Description: NF17676
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17676_low_23
NF17676_low_23
[»] chr8 (1 HSPs)
chr8 (112-302)||(43037466-43037657)


Alignment Details
Target: chr8 (Bit Score: 180; Significance: 3e-97; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 180; E-Value: 3e-97
Query Start/End: Original strand, 112 - 302
Target Start/End: Complemental strand, 43037657 - 43037466
Alignment:
Q  112 attcaacaacctccgcccccgctttccaccttgactatgccgctctccatcgtctctccggcaaactcctcac-ctctccatctttgtttacaacggccc 210  Q
    |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||    
T  43037657 attcaacaacctccgcccccgctttccaccttgactatgctgctctccatcgtctctccggcaaactcctcactctctccatctttgtttacaacggccc 43037558  T
Q  211 aattggccgcaactgtggcgtccgcaatgccaagctactcggtcgtgtccttcttcccattcaattacctacctcattctcttcccccaata 302  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  43037557 aattggccgcaactgtggcgtccgcaatgccaagctactcggtcgtgtccttcttcccattcaattacctacctcattctcttcccccaata 43037466  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University