View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17674_low_4 (Length: 318)

Name: NF17674_low_4
Description: NF17674
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17674_low_4
NF17674_low_4
[»] chr3 (1 HSPs)
chr3 (16-182)||(48491859-48492023)


Alignment Details
Target: chr3 (Bit Score: 133; Significance: 4e-69; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 133; E-Value: 4e-69
Query Start/End: Original strand, 16 - 182
Target Start/End: Complemental strand, 48492023 - 48491859
Alignment:
Q  16 atgaaatttggggggttcccgctctaacgggtacaactatgagtcnnnnnnncatgaatgacgaaactgcacgatatttatatccttttcgacacgtcac 115  Q
    |||||||||||||||||||||||||||||||||||||||||||||       | ||||||||||||||||||||||||||||||||||||||||||||||    
T  48492023 atgaaatttggggggttcccgctctaacgggtacaactatgagtcaaaaa--cttgaatgacgaaactgcacgatatttatatccttttcgacacgtcac 48491926  T
Q  116 catctttatcggttacttcaccttttcggtttctctttacgccttcaccttcgcttcaccgtatcca 182  Q
    |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||    
T  48491925 catctttatcggttacttcaccttttcgatttctctttacgccttcaccttcgcttcaccgtatcca 48491859  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University