View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17670_low_13 (Length: 262)

Name: NF17670_low_13
Description: NF17670
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17670_low_13
NF17670_low_13
[»] chr2 (1 HSPs)
chr2 (13-241)||(4759725-4759953)
[»] chr4 (2 HSPs)
chr4 (69-198)||(26982154-26982283)
chr4 (69-121)||(26999135-26999187)


Alignment Details
Target: chr2 (Bit Score: 221; Significance: 1e-122; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 13 - 241
Target Start/End: Complemental strand, 4759953 - 4759725
Alignment:
Q  13 agcatagggaggaggaggaggtggtggaagaaactgaaattttgctgcaaaagacagtgaagatgcttcactttggaagctgggaagagaaggagatagc 112  Q
    |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  4759953 agcataaggaggaggaggaggtggtggaagaaactgaaattttgctgcaaaagacagtgaagatgcttcactttggaagctgggaagagaaggagatagc 4759854  T
Q  113 tgcaaaagagattgaaagtttagttaaagaagatgttaaggttagaaagttgataacagaacttggagtggtgccggttttggtatctatggtggcgtcg 212  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||     
T  4759853 tgcaaaagagattgaaagtttagttaaagaagatgttaaggttagaaagttgataacagaacttggagtggtgccggttttggtatctatggtggcgtca 4759754  T
Q  213 caggtggttagtcaccggagagcagggtt 241  Q
    |||||||||||||||||||||||||||||    
T  4759753 caggtggttagtcaccggagagcagggtt 4759725  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 46; Significance: 3e-17; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 69 - 198
Target Start/End: Complemental strand, 26982283 - 26982154
Alignment:
Q  69 gtgaagatgcttcactttggaagctgggaagagaaggagatagctgcaaaagagattgaaagtttagttaaagaagatgttaaggttagaaagttgataa 168  Q
    ||||||| |||||||||||| |||||||||||||| |||  ||| |||||||| ||||| |   | | |||| ||||||||||||| ||||||||||| |    
T  26982283 gtgaagaagcttcactttgggagctgggaagagaaagaggaagcagcaaaagatattgagatgctggctaaacaagatgttaaggtcagaaagttgatga 26982184  T
Q  169 cagaacttggagtggtgccggttttggtat 198  Q
    | |||||| | |||||||| || |||||||    
T  26982183 ctgaacttcgggtggtgcctgtattggtat 26982154  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 69 - 121
Target Start/End: Original strand, 26999135 - 26999187
Alignment:
Q  69 gtgaagatgcttcactttggaagctgggaagagaaggagatagctgcaaaaga 121  Q
    ||||||| |||||||||||| |||||||||||||| |||  ||| ||||||||    
T  26999135 gtgaagaagcttcactttgggagctgggaagagaaagaggaagcagcaaaaga 26999187  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University