View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17662_high_19 (Length: 235)

Name: NF17662_high_19
Description: NF17662
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17662_high_19
NF17662_high_19
[»] scaffold0028 (1 HSPs)
scaffold0028 (1-48)||(125566-125613)


Alignment Details
Target: scaffold0028 (Bit Score: 44; Significance: 3e-16; HSPs: 1)
Name: scaffold0028
Description:

Target: scaffold0028; HSP #1
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 125613 - 125566
Alignment:
Q  1 ctgttcatcttcctggtaataatttcaaaacgtttatactgaatattc 48  Q
    |||||||||||||||||||||||||||||||||||||| |||||||||    
T  125613 ctgttcatcttcctggtaataatttcaaaacgtttatattgaatattc 125566  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University