View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17661_low_67 (Length: 210)

Name: NF17661_low_67
Description: NF17661
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17661_low_67
NF17661_low_67
[»] chr6 (1 HSPs)
chr6 (18-199)||(1240870-1241051)


Alignment Details
Target: chr6 (Bit Score: 161; Significance: 5e-86; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 18 - 199
Target Start/End: Complemental strand, 1241051 - 1240870
Alignment:
Q  18 gtctcatattccaaattgttggaatgttttcttttttgattcaaacaacgttagctagctagnnnnnnngtccttttatgcatccaactgtcactgttcc 117  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||       |||||||||||||||||||||||||||||||    
T  1241051 gtctcatattccaaattgttggaatgttttcttttttgattcaaacaacgttagctagctagtttttttgtccttttatgcatccaactgtcactgttcc 1240952  T
Q  118 attcctactcttcagtacccttctttctactcaaagttagggcttttcaccaagttgcaggtaacaacatcacttcttctca 199  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  1240951 attcctactcttcagtacccttctttctactcaaagttagggcttttcaccaagttgcaggtaacaacatcacttcttctca 1240870  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University