View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17661_low_35 (Length: 297)

Name: NF17661_low_35
Description: NF17661
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17661_low_35
NF17661_low_35
[»] chr7 (2 HSPs)
chr7 (136-285)||(36681588-36681737)
chr7 (23-138)||(36681768-36681883)


Alignment Details
Target: chr7 (Bit Score: 146; Significance: 6e-77; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 146; E-Value: 6e-77
Query Start/End: Original strand, 136 - 285
Target Start/End: Complemental strand, 36681737 - 36681588
Alignment:
Q  136 aatataaccaaacatatgatgagatatattggtgttatgaacagactagtggcttttactagtgaaaagtggacactgagaatacccttaatataaatca 235  Q
    ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  36681737 aatataaccaaacttatgatgagatatattggtgttatgaacagactagtggcttttactagtgaaaagtggacactgagaatacccttaatataaatca 36681638  T
Q  236 gtgtgtcgctttagacagttggaaaatccataaatagatgtaccgtcttc 285  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||    
T  36681637 gtgtgtcgctttagacagttggaaaatccataaatagatgtaccgtcttc 36681588  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 108; E-Value: 3e-54
Query Start/End: Original strand, 23 - 138
Target Start/End: Complemental strand, 36681883 - 36681768
Alignment:
Q  23 caacatgggagaacagatgaatgaaaaacaaaatcaacttgcattattgtctctagagatattctaaattccgtgaaacacaaaaacaaagtttagaaat 122  Q
    ||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  36681883 caacatgggagaacaaatgaataaaaaacaaaatcaacttgcattattgtctctagagatattctaaattccgtgaaacacaaaaacaaagtttagaaat 36681784  T
Q  123 tggatttacagtgaat 138  Q
    ||||||||||||||||    
T  36681783 tggatttacagtgaat 36681768  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University