View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17661_high_43 (Length: 251)

Name: NF17661_high_43
Description: NF17661
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17661_high_43
NF17661_high_43
[»] chr7 (1 HSPs)
chr7 (18-242)||(44801453-44801674)


Alignment Details
Target: chr7 (Bit Score: 166; Significance: 6e-89; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 166; E-Value: 6e-89
Query Start/End: Original strand, 18 - 242
Target Start/End: Complemental strand, 44801674 - 44801453
Alignment:
Q  18 aatgtctacggctataagttgattagaatatgaactagtgaaccggacaaactaaaccaatctaatatgtaaaatacaacgagcactatgcaaatagnnn 117  Q
    |||||||||||||||||||||||||||   |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||       
T  44801674 aatgtctacggctataagttgattaga---tgaactagtgaaccggacaaactaaaccaatctaatatgtaaaatacaacgagcactatgcaaatagttt 44801578  T
Q  118 nnnnaattaaattgtagtaaaatttatgtcttacatatgtgatggtnnnnnnnngtccactttcacacggtccctttcataagaaaccatctctctcaaa 217  Q
        ||||||||||||||||||||||||||||||||||||||||||        ||||||||||||||||||||||||||||||||||||||||||||||    
T  44801577 ttttaattaaattgtagtaaaatttatgtcttacatatgtgatggtaaaaaaaagtccactttcacacggtccctttcataagaaaccatctctctcaaa 44801478  T
Q  218 cacttagaaaccctaactttcatct 242  Q
    |||||||||||||||||||||||||    
T  44801477 cacttagaaaccctaactttcatct 44801453  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University