View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17657_low_55 (Length: 245)

Name: NF17657_low_55
Description: NF17657
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17657_low_55
NF17657_low_55
[»] chr4 (1 HSPs)
chr4 (18-218)||(45895041-45895241)


Alignment Details
Target: chr4 (Bit Score: 131; Significance: 4e-68; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 131; E-Value: 4e-68
Query Start/End: Original strand, 18 - 218
Target Start/End: Complemental strand, 45895241 - 45895041
Alignment:
Q  18 agtagcaggaggtggagctaaatatggacccgctgcagtgtcttttgattgatcgtcatatgctacagtataattccaaaatacaattacgaataatata 117  Q
    ||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||| || ||||||    
T  45895241 agtagcaggaggtggagctaaatatggacccactgcagtgtcttttgattgatcatcatatgctacagtataattccaaaatgcaattacaaacaatata 45895142  T
Q  118 cacaattttgtcnnnnnnnnnnnnnntaatatacacaacagcattggaattaataagagtatatcttttaattaactacaaaatcttcttttacacacta 217  Q
    ||||| ||||||              |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||    
T  45895141 cacaactttgtcaaaaaaataaaaaataatatacacaacagcattggaattaataagagtatttcttttaattaactacaaaatcttcttttacacacta 45895042  T
Q  218 a 218  Q
    |    
T  45895041 a 45895041  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University