View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17651_low_107 (Length: 264)

Name: NF17651_low_107
Description: NF17651
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17651_low_107
NF17651_low_107
[»] chr1 (1 HSPs)
chr1 (176-253)||(38278690-38278768)


Alignment Details
Target: chr1 (Bit Score: 71; Significance: 3e-32; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 176 - 253
Target Start/End: Complemental strand, 38278768 - 38278690
Alignment:
Q  176 aatatagacaaatgtaatggttttctaactatcaaacttt-aatctcattcttagtatttcttcgtcatctcaattcat 253  Q
    |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||    
T  38278768 aatatagacaaatgtaatggttttctaactatcaaactttgaatctcattcttagtatttcttcgtcatctcaattcat 38278690  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University