View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17651_high_56 (Length: 379)

Name: NF17651_high_56
Description: NF17651
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17651_high_56
NF17651_high_56
[»] chr5 (1 HSPs)
chr5 (24-138)||(2623262-2623370)


Alignment Details
Target: chr5 (Bit Score: 92; Significance: 1e-44; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 92; E-Value: 1e-44
Query Start/End: Original strand, 24 - 138
Target Start/End: Complemental strand, 2623370 - 2623262
Alignment:
Q  24 ttggagagcaataatcaggtaccttttttactagactaacaacggcggaggagtcaacttcaacttcaacgagaagagaataaatagaaaaacttttatt 123  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||      ||||||||||||||||||||||||||||||||||    
T  2623370 ttggagagcaataatcaggtaccttttttactagactaacaacggcggaggagtcaactt------caacgagaagagaataaatagaaaaacttttatt 2623277  T
Q  124 gagcttcaagccaag 138  Q
    |||||||||||||||    
T  2623276 gagcttcaagccaag 2623262  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University