View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17647_high_22 (Length: 339)

Name: NF17647_high_22
Description: NF17647
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17647_high_22
NF17647_high_22
[»] chr1 (2 HSPs)
chr1 (19-107)||(4907411-4907498)
chr1 (173-227)||(4906900-4906954)


Alignment Details
Target: chr1 (Bit Score: 69; Significance: 6e-31; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 69; E-Value: 6e-31
Query Start/End: Original strand, 19 - 107
Target Start/End: Complemental strand, 4907498 - 4907411
Alignment:
Q  19 tgaagccagtttctaatttgggaggatgatttgtttggacacaaggatttgaatactctatttaagcgcacacgtttgagagaaggctg 107  Q
    |||||||||||||||||| ||||||||||||||||||| |||||||||||||||||| ||||||| |||||||||||||||||||||||    
T  4907498 tgaagccagtttctaatt-gggaggatgatttgtttggtcacaaggatttgaatactttatttaaacgcacacgtttgagagaaggctg 4907411  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 173 - 227
Target Start/End: Complemental strand, 4906954 - 4906900
Alignment:
Q  173 tgtgtccaaatacttgttgcaatcaaataatatgcaatttttaaaaaagtaagta 227  Q
    ||||||||||||||||||||||||||||||||||||||||  |||||||||||||    
T  4906954 tgtgtccaaatacttgttgcaatcaaataatatgcaatttaaaaaaaagtaagta 4906900  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University