View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17642_low_9 (Length: 234)

Name: NF17642_low_9
Description: NF17642
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17642_low_9
NF17642_low_9
[»] chr7 (1 HSPs)
chr7 (18-52)||(29690969-29691003)


Alignment Details
Target: chr7 (Bit Score: 35; Significance: 0.00000000008; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 18 - 52
Target Start/End: Original strand, 29690969 - 29691003
Alignment:
Q  18 ggaagttggaaggagagaggagaggggttgaaccc 52  Q
    |||||||||||||||||||||||||||||||||||    
T  29690969 ggaagttggaaggagagaggagaggggttgaaccc 29691003  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University