View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17640_low_30 (Length: 342)

Name: NF17640_low_30
Description: NF17640
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17640_low_30
NF17640_low_30
[»] chr8 (1 HSPs)
chr8 (19-329)||(7499932-7500242)


Alignment Details
Target: chr8 (Bit Score: 295; Significance: 1e-166; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 295; E-Value: 1e-166
Query Start/End: Original strand, 19 - 329
Target Start/End: Complemental strand, 7500242 - 7499932
Alignment:
Q  19 cagatgttgacgaagattgaggtggggtactccaccatgatgttggggcaaaaatggcaggtgaatgtcacgtgccgctggaaaggtggaggagatcggt 118  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  7500242 cagatgttgacgaagattgaggtggggtactccaccatgatgttggggcaaaaatggcaggtgaatgtcacgtgccgctggaaaggtggaggagatcggt 7500143  T
Q  119 tgtacgtgaggattgttgagtttggaatagagcgtatgaccggagaactggggaggcaagctggcattaatctcgtgaatgcaattcaaaatggagagag 218  Q
    |||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  7500142 tgtacgtgaggattgttgtgtttggaatagagcatatgaccggagaactggggaggcaagctggcattaatctcgtgaatgcaattcaaaatggagagag 7500043  T
Q  219 gattatatttgattgaaaaggtttataccaattcttaaatatttcatttaaatctactaggttttcatggttagaacaattgtggtaattggattggatg 318  Q
    ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  7500042 gattatatttgattgaaaaggtttataccaatttttaaatatttcatttaaatctactaggttttcatggttagaacaattgtggtaattggattggatg 7499943  T
Q  319 tgttttccttc 329  Q
    |||||| ||||    
T  7499942 tgttttacttc 7499932  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University