View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17640_high_23 (Length: 374)

Name: NF17640_high_23
Description: NF17640
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17640_high_23
NF17640_high_23
[»] chr5 (3 HSPs)
chr5 (240-364)||(36288758-36288882)
chr5 (16-108)||(36289004-36289096)
chr5 (16-108)||(36300453-36300545)


Alignment Details
Target: chr5 (Bit Score: 93; Significance: 3e-45; HSPs: 3)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 93; E-Value: 3e-45
Query Start/End: Original strand, 240 - 364
Target Start/End: Complemental strand, 36288882 - 36288758
Alignment:
Q  240 tatattttagtgtggggttgattatatggggttagagattgccagaatatgccgccgaaaaattgactcggttagtaaaaagttgactcatacggtggat 339  Q
    |||||||| |||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||| || ||||||||||||||||||| |||||    
T  36288882 tatattttggtgtggggttgattatatggggttagagattgccagaatatggcgtcgaaaaattgactcggataataaaaagttgactcatacgttggat 36288783  T
Q  340 taaatttccacttgtaagggttcat 364  Q
    |||||||||  ||||||||||||||    
T  36288782 taaatttccggttgtaagggttcat 36288758  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 89; E-Value: 8e-43
Query Start/End: Original strand, 16 - 108
Target Start/End: Complemental strand, 36289096 - 36289004
Alignment:
Q  16 tttgtttgtacgaggtatggttttgaggactagaatcgatctcatttgtggtggaaaattcatcacttgcggtgtacacgggaaagccaggca 108  Q
    ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  36289096 tttgtttgtacgaggtatggttttgaggactaggatcgatctcatttgtggtggaaaattcatcacttgcggtgtacacgggaaagccaggca 36289004  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 16 - 108
Target Start/End: Complemental strand, 36300545 - 36300453
Alignment:
Q  16 tttgtttgtacgaggtatggttttgaggactagaatcgatctcatttgtggtggaaaattcatcacttgcggtgtacacgggaaagccaggca 108  Q
    |||||| ||||||||||||||||||| |||||| || ||||||||||||| |||| |||||||||||   || ||||| ||||||||||||||    
T  36300545 tttgttggtacgaggtatggttttgaagactaggattgatctcatttgtgttggagaattcatcactacaggcgtacatgggaaagccaggca 36300453  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University