View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1763_low_101 (Length: 236)

Name: NF1763_low_101
Description: NF1763
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1763_low_101
NF1763_low_101
[»] scaffold0219 (2 HSPs)
scaffold0219 (86-220)||(9520-9654)
scaffold0219 (33-84)||(10235-10288)


Alignment Details
Target: scaffold0219 (Bit Score: 135; Significance: 2e-70; HSPs: 2)
Name: scaffold0219
Description:

Target: scaffold0219; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 86 - 220
Target Start/End: Complemental strand, 9654 - 9520
Alignment:
Q  86 tatgccaattttagtttcgatccccaaaataactgattttgccaattaattcatttaggtggacaaatttagtgcaaagtttgatgctgctggaagcaat 185  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  9654 tatgccaattttagtttcgatccccaaaataactgattttgccaattaattcatttaggtggacaaatttagtgcaaagtttgatgctgctggaagcaat 9555  T
Q  186 ggtcatcacttgttgtgctttcaagaactttgtag 220  Q
    |||||||||||||||||||||||||||||||||||    
T  9554 ggtcatcacttgttgtgctttcaagaactttgtag 9520  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0219; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 33 - 84
Target Start/End: Complemental strand, 10288 - 10235
Alignment:
Q  33 accttgcgaagaagttgtttccatggcaaatat--gaggtacgcacgatgccga 84  Q
    |||||||||||||||||||||||||||||||||  |||||||||||||||||||    
T  10288 accttgcgaagaagttgtttccatggcaaatatgagaggtacgcacgatgccga 10235  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University