View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17638_low_12 (Length: 378)

Name: NF17638_low_12
Description: NF17638
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17638_low_12
NF17638_low_12
[»] chr3 (3 HSPs)
chr3 (138-368)||(11023094-11023324)
chr3 (19-70)||(11022975-11023026)
chr3 (138-197)||(11008533-11008591)


Alignment Details
Target: chr3 (Bit Score: 219; Significance: 1e-120; HSPs: 3)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 138 - 368
Target Start/End: Original strand, 11023094 - 11023324
Alignment:
Q  138 cctacatgctagtgcggtgctttgtacgttttgctctcatccggggtacgtcttgtgcttggtcctgaaatttgtacaaccgacagaagctggcttagta 237  Q
    |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  11023094 cctacatgctagtgcggtgctttgtacgttttgctctcatccggggcacgtcttgtgcttggtcctgaaatttgtacaaccgacagaagctggcttagta 11023193  T
Q  238 attgttaatagtaccgtcatctgaaattgttaattcgggtcagcgttttatacatgttagtcgcaaaatatagattgactgattcttccttcgttgatca 337  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||    
T  11023194 attgttaatagtaccgtcatctgaaattgttaattcgggtcagcgttttatacatgttagtcgcaaaatatagattgactgatgcttccttcgttgatca 11023293  T
Q  338 atttcccacactctcaagttcaccgcctttg 368  Q
    |||||||||||||||||||||||| ||||||    
T  11023294 atttcccacactctcaagttcaccacctttg 11023324  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 19 - 70
Target Start/End: Original strand, 11022975 - 11023026
Alignment:
Q  19 gctttagcctcagctttgttcctcatttcatgttctctttctttaggttcca 70  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  11022975 gctttagcctcagctttgttcctcatttcatgttctctttctttaggttcca 11023026  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 138 - 197
Target Start/End: Original strand, 11008533 - 11008591
Alignment:
Q  138 cctacatgctagtgcggtgctttgtacgttttgctctcatccggggtacgtcttgtgctt 197  Q
    ||||||||||||||| ||||| ||||| ||||||||| || |||||||||| ||||||||    
T  11008533 cctacatgctagtgcagtgctctgtacattttgctcttat-cggggtacgtgttgtgctt 11008591  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University