View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17635_low_57 (Length: 233)

Name: NF17635_low_57
Description: NF17635
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17635_low_57
NF17635_low_57
[»] chr1 (1 HSPs)
chr1 (29-221)||(9539912-9540102)


Alignment Details
Target: chr1 (Bit Score: 169; Significance: 9e-91; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 169; E-Value: 9e-91
Query Start/End: Original strand, 29 - 221
Target Start/End: Complemental strand, 9540102 - 9539912
Alignment:
Q  29 tgatagtatgatttttatccatgttaggatttccccattaagttaatgtatgtgtttgtgcttgcactttctgctggaatatgtttttaagctatgagaa 128  Q
    ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||| ||    
T  9540102 tgatagtatgatttt-atccatgttaggatttccccattaagttaatgtatgtgtttgtgcttgcactttctgctagaatatatttttaagctatga-aa 9540005  T
Q  129 tcggttactacaactgccatgcctcgaaaaactgtgtttttagcactgataaccgattacactaagtgtgcaaccggttgcacactaggaagt 221  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  9540004 tcggttactacaactgccatgcctcgaaaaactgtgtttttagcactgataaccgattacactaagtgtgcaaccggttgcacactaggaagt 9539912  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University