View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17635_high_45 (Length: 263)

Name: NF17635_high_45
Description: NF17635
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17635_high_45
NF17635_high_45
[»] chr7 (2 HSPs)
chr7 (138-247)||(41130833-41130942)
chr7 (11-67)||(41131013-41131069)


Alignment Details
Target: chr7 (Bit Score: 98; Significance: 2e-48; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 98; E-Value: 2e-48
Query Start/End: Original strand, 138 - 247
Target Start/End: Complemental strand, 41130942 - 41130833
Alignment:
Q  138 tgctaacctagtttacctcctctttgatatcgtctccaaatcataattactattatagtctcttccttcaaaacggtacgttccatctttcttatttggt 237  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||  |    
T  41130942 tgctaacctagtttacctcctctttgatatcgtctccaaatcataattactattatagtctcttccttcaaaacggtacgttccatctttcttatttaat 41130843  T
Q  238 tttaataatt 247  Q
    ||| ||||||    
T  41130842 ttttataatt 41130833  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 11 - 67
Target Start/End: Complemental strand, 41131069 - 41131013
Alignment:
Q  11 gagcagagatgctagtggtgttaattataggctctccctttgcaataattctcacaa 67  Q
    ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||    
T  41131069 gagcaaagatgctagtggtgttaattataggctctccctttgcaataattctcacaa 41131013  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University