View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17632_low_18 (Length: 253)

Name: NF17632_low_18
Description: NF17632
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17632_low_18
NF17632_low_18
[»] chr4 (2 HSPs)
chr4 (1-88)||(55245681-55245768)
chr4 (157-246)||(55245833-55245922)


Alignment Details
Target: chr4 (Bit Score: 88; Significance: 2e-42; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 1 - 88
Target Start/End: Original strand, 55245681 - 55245768
Alignment:
Q  1 cttcttcaagcttgaattagccagctcctcacaattactagggtatgtttttgaataagagttatccatgtagtgctatagtgtaatt 88  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  55245681 cttcttcaagcttgaattagccagctcctcacaattactagggtatgtttttgaataagagttatccatgtagtgctatagtgtaatt 55245768  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 157 - 246
Target Start/End: Original strand, 55245833 - 55245922
Alignment:
Q  157 gtagtaattggggtatgtatgggcaacagtgtcgagtagctagcattgtggtccttggtacgatctgactcatactctgtgtctgtgctc 246  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||    
T  55245833 gtagtaattggggtatgtatgggcaacagtgtcgagtagctagcattgtggtccttggtacgatctgactcatactctgtgtctgggctc 55245922  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University