View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17625_low_57 (Length: 210)

Name: NF17625_low_57
Description: NF17625
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17625_low_57
NF17625_low_57
[»] chr6 (1 HSPs)
chr6 (23-192)||(8941680-8941849)


Alignment Details
Target: chr6 (Bit Score: 154; Significance: 7e-82; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 154; E-Value: 7e-82
Query Start/End: Original strand, 23 - 192
Target Start/End: Complemental strand, 8941849 - 8941680
Alignment:
Q  23 ccggtctctgccatctacatacccccggccttgaaaccgtattctgctgtgcatatggcagtgtgacagcagctgtattttgctgttgacagtcgcgcat 122  Q
    ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||    
T  8941849 ccggtctctgccatctacatacccctggccttgaaaccgtattctgctgtgcatatggcagtgtgacagcagctgtgttttgctgttgacagtcgtgcat 8941750  T
Q  123 ctgctgcttcttgttagcaaacctccaatcctcgattaaatgcttggccctcgaaactatattgcttttc 192  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||    
T  8941749 ctgctgcttcttgttagcaaacctccaatcctcgattaaatgcttggccctcgcaactatattgcttttc 8941680  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University