View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17625_low_40 (Length: 284)

Name: NF17625_low_40
Description: NF17625
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17625_low_40
NF17625_low_40
[»] chr7 (2 HSPs)
chr7 (96-270)||(34608543-34608717)
chr7 (18-53)||(34608509-34608544)


Alignment Details
Target: chr7 (Bit Score: 163; Significance: 4e-87; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 163; E-Value: 4e-87
Query Start/End: Original strand, 96 - 270
Target Start/End: Original strand, 34608543 - 34608717
Alignment:
Q  96 tcgactcgagagattattctctactattacgcagataaacacagatgatactcgatttacgaacattacatatgaaagcaacataaacgtacaaaatttg 195  Q
    |||||||||||||||||||||||  |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  34608543 tcgactcgagagattattctctatcattacgcagatacacacagatgatactcgatttacgaacattacatatgaaagcaacataaacgtacaaaatttg 34608642  T
Q  196 tttccatgaacggaccacataaataaatattcagaaataaaaatatctgaacattattacctcacactctctctg 270  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  34608643 tttccatgaacggaccacataaataaatattcagaaataaaaatatctgaacattattacctcacactctctctg 34608717  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 18 - 53
Target Start/End: Original strand, 34608509 - 34608544
Alignment:
Q  18 atgcattattatgtgaaaatataattagcagtcatc 53  Q
    ||||||||||||||||||||||||||||||| ||||    
T  34608509 atgcattattatgtgaaaatataattagcaggcatc 34608544  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University